ID: 956177202

View in Genome Browser
Species Human (GRCh38)
Location 3:66484171-66484193
Sequence GGAAATACACAGATGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956177202 Original CRISPR GGAAATACACAGATGAAGCC TGG Intronic
900774412 1:4571345-4571367 GGCAACACACATATGAAGCTGGG - Intergenic
902537586 1:17129761-17129783 TTAAATACACAAATGAGGCCGGG - Intergenic
903388180 1:22943555-22943577 AGAAATATACAGATGTAGGCCGG + Intergenic
904894124 1:33801385-33801407 GGAAAAACAAAGATGTAGACAGG - Intronic
907410403 1:54279573-54279595 GGAGGCACACAGATGAAGCATGG + Intronic
907646503 1:56249777-56249799 GGAAATAAACAGAAGAAACCTGG - Intergenic
907773997 1:57494862-57494884 GGAATTTCACAGCTGAAGCAAGG - Intronic
908534552 1:65066410-65066432 GGAAATAAACAGGTGAGCCCGGG + Intergenic
908616608 1:65929370-65929392 GGGAAGACACTGATGAAGCTGGG - Intronic
909056532 1:70827359-70827381 TGGAATACAGATATGAAGCCTGG - Intergenic
909615911 1:77607628-77607650 GAAAATACAGAGAGGAGGCCGGG + Intronic
909649297 1:77955587-77955609 GGAAATACACTGAGGACACCAGG + Intronic
910481257 1:87660735-87660757 GGTAATACAAAGATGAAGCAGGG + Intergenic
910707180 1:90142193-90142215 ACAAACACACAGATGAGGCCAGG - Intergenic
911584909 1:99679454-99679476 GGAAAAAAAAAGATAAAGCCCGG + Intronic
911720163 1:101182259-101182281 GGAAATAGTGAGATGAACCCAGG + Intergenic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
914252070 1:145929723-145929745 GGAAATACACAGTTAAAGACAGG - Intergenic
915238813 1:154504776-154504798 TTAAAAACACAGATAAAGCCTGG + Intronic
915691941 1:157698637-157698659 GGAAATAGAAAGATGAAGGCAGG + Intronic
916248874 1:162716440-162716462 AGAAACACACAGGTGAATCCTGG - Intronic
917138375 1:171809893-171809915 GGACATAGACAGCAGAAGCCAGG + Intronic
917233066 1:172858567-172858589 AGAAATAGACATATAAAGCCAGG - Intergenic
917834884 1:178933628-178933650 GGAAATATACAGTTGAGGCTGGG + Intergenic
917945640 1:179967903-179967925 ACAAATACACATATGAAGCCAGG - Intronic
919418382 1:197340284-197340306 GGAAATACCTATATGCAGCCTGG + Intronic
919544026 1:198890318-198890340 GGAAACACAAAGAGGATGCCTGG - Intergenic
920926670 1:210348082-210348104 AGAAATGTACAGATGAGGCCTGG + Intronic
922830907 1:228553666-228553688 AGAAATACCTGGATGAAGCCAGG - Intergenic
923309470 1:232721885-232721907 TTATATACAAAGATGAAGCCAGG + Intergenic
1064099548 10:12451485-12451507 GGAAATCCTCAAATGGAGCCAGG - Intronic
1064112799 10:12553036-12553058 AGAAATACACAGGGGCAGCCCGG - Intronic
1064564942 10:16630519-16630541 TGAGATACAGAGATGAAGGCAGG - Intronic
1064748016 10:18496913-18496935 AGAAATACATAGAAGAGGCCAGG + Intronic
1064762878 10:18639331-18639353 AAAAATACAAAAATGAAGCCAGG + Intronic
1065137252 10:22684015-22684037 TGAAATACTCACAAGAAGCCTGG + Intronic
1065547000 10:26831749-26831771 GGAAACAATCAGATGAATCCAGG - Intronic
1065964543 10:30760589-30760611 AGAAATACACACATGAGGCTGGG - Intergenic
1067124037 10:43500168-43500190 AAAAATATAAAGATGAAGCCAGG - Intergenic
1067250021 10:44578279-44578301 GGAAATGCACAGATGGGTCCAGG + Intergenic
1068638658 10:59376601-59376623 AGAAATGCACATATGGAGCCTGG + Intergenic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1068893818 10:62177940-62177962 GGAAATATACAGGAGGAGCCTGG + Intergenic
1069212765 10:65781648-65781670 GGAATGTCACAGATAAAGCCTGG + Intergenic
1069981389 10:72255236-72255258 GGAAACAAACAGATGAAGGAGGG - Intergenic
1070538869 10:77401550-77401572 GGAAAAACAGAGAAGGAGCCTGG - Intronic
1071949147 10:90683026-90683048 GGAACTACACAGATAGAGACAGG - Intergenic
1072976198 10:100060958-100060980 GCAAAAACAGGGATGAAGCCAGG + Intronic
1073587803 10:104727448-104727470 GGAAATATGCAGATGATGACTGG - Intronic
1074370582 10:112898006-112898028 AGAAATAAACAGATAAGGCCAGG + Intergenic
1074754995 10:116617908-116617930 GGAGAGACACAGGTGAGGCCAGG + Intergenic
1074856033 10:117474289-117474311 GGAGAGAAACAGATGAGGCCAGG + Intergenic
1075386507 10:122059210-122059232 TTAAAAACACAGATGGAGCCCGG - Intronic
1075511121 10:123073730-123073752 GCAAATACAGGGAAGAAGCCAGG - Intergenic
1075928383 10:126271890-126271912 GGAGAGAGACAGAGGAAGCCAGG - Intronic
1076058484 10:127394803-127394825 TGAAATACCGAGATGGAGCCAGG + Intronic
1076662767 10:132066407-132066429 GGCAATACACAGACTCAGCCTGG - Intergenic
1077626755 11:3779155-3779177 GGAAATTCACAGACTAAACCAGG - Exonic
1078118937 11:8486426-8486448 GGAATTATACAGATGAAGAGAGG - Intronic
1078664229 11:13311200-13311222 GGAAATGCAGGGCTGAAGCCTGG + Intronic
1079619966 11:22541999-22542021 TAAAATATAGAGATGAAGCCAGG + Intergenic
1079810301 11:24990539-24990561 GTAAATGCAGAGATGAAGACTGG + Intronic
1080984489 11:37445202-37445224 AGAAATACAAAAATAAAGCCTGG - Intergenic
1081838084 11:46174412-46174434 AGAAATACAGAGAAGAGGCCGGG - Intergenic
1082258071 11:50054141-50054163 AAAAATACACAGGGGAAGCCAGG + Intergenic
1082882888 11:58055637-58055659 GAAAATACAAAAATGTAGCCAGG + Intronic
1083694111 11:64431188-64431210 GAAGATACAAAGGTGAAGCCAGG - Intergenic
1084433710 11:69125975-69125997 AGAAGGACACAGATGACGCCTGG - Intergenic
1085109591 11:73875968-73875990 GGAAGCACAGAGATGAAGCCGGG + Intronic
1085233568 11:74993539-74993561 TGAAATACTCACATGAAGCTAGG + Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1088013894 11:105036381-105036403 GGAAAGACAAACATGAAGGCTGG + Intergenic
1088014904 11:105046582-105046604 GGAAAGATACACATGAAACCTGG + Intronic
1088016997 11:105072789-105072811 GGGAAGACAAACATGAAGCCTGG + Intronic
1088019547 11:105102691-105102713 GGGAAGACAAACATGAAGCCTGG + Intergenic
1090155127 11:124429100-124429122 GGAGATAAAAAGATAAAGCCTGG + Intergenic
1090859493 11:130640364-130640386 GGAAGTACACAGAGGAAGAGAGG - Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1092736466 12:11587570-11587592 GGAAAGACAGAGATACAGCCAGG - Intergenic
1093833547 12:23797315-23797337 GGATATACACAGATGTATCTTGG + Intronic
1094007754 12:25773454-25773476 GGAAATATATAGATGAGGCCAGG - Intergenic
1094240146 12:28213037-28213059 GGAAAGACCCTGATGAAGCTGGG + Intronic
1097613403 12:61854322-61854344 AGAAAGATACAGATGAAGGCAGG + Intronic
1099441264 12:82702629-82702651 AGAACTAAACAGAAGAAGCCAGG + Intronic
1100763757 12:97839437-97839459 GGAAGTACACAGATGGGCCCAGG + Intergenic
1101713955 12:107294384-107294406 GGTGATACAAAGATGAATCCTGG + Intergenic
1102359540 12:112272479-112272501 CGAAATACACAGATCCATCCAGG - Intronic
1104493173 12:129212348-129212370 GGAAATACACAGAGGAGGCAGGG - Intronic
1107021623 13:35757967-35757989 GGAAGTACACCAATGAATCCAGG + Intergenic
1107524036 13:41212782-41212804 GAAAATACACAGAGGAGGCAGGG - Intergenic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1108924265 13:55719500-55719522 GGAAATATACAAAATAAGCCTGG + Intergenic
1110065871 13:71104585-71104607 GGAGAAACTTAGATGAAGCCAGG - Intergenic
1110447546 13:75603332-75603354 GAAAATACATATATTAAGCCAGG + Intronic
1110749748 13:79098853-79098875 GGAAATACACAGAGGGAACTAGG - Intergenic
1111761737 13:92475107-92475129 GAAAATAAACAGTTGAAGTCAGG + Intronic
1112519910 13:100086121-100086143 GGCACTACACAGAAGCAGCCTGG - Intergenic
1112896223 13:104303719-104303741 GGAAATACACAGTAGAAGAAAGG + Intergenic
1113671576 13:112179078-112179100 GCAAAAACACACATGAAACCTGG - Intergenic
1113841180 13:113362748-113362770 GGAAGGACAGAGATGAAACCAGG - Intronic
1114338127 14:21714256-21714278 TGAAATTCACAGATCAACCCTGG - Intergenic
1117192510 14:53306722-53306744 GGAAATACGCTGATGTATCCTGG - Intergenic
1117626811 14:57648957-57648979 GGAAGGACAGAGATGAGGCCAGG - Intronic
1120067880 14:80066000-80066022 GGAAACACACAAATAAAGTCAGG + Intergenic
1120573209 14:86147662-86147684 GGAAAAACAGAGATGACCCCTGG - Intergenic
1120930636 14:89844775-89844797 GGAATTACAAAAATGAGGCCAGG - Intronic
1121062801 14:90931977-90931999 GGATATACACACATGAAGTAAGG + Intronic
1121338307 14:93090359-93090381 GGAAGGACACAGAGGAACCCAGG + Intronic
1124066733 15:26351641-26351663 TGAAAAAAGCAGATGAAGCCAGG - Intergenic
1124429701 15:29595951-29595973 GGAAATATACAGGATAAGCCGGG - Intergenic
1126593548 15:50363542-50363564 AGAAATACACAGAATTAGCCAGG - Intergenic
1126837019 15:52678561-52678583 GTAATTACACAGGTGAGGCCCGG - Intronic
1126901727 15:53321477-53321499 GGAAATGCACAGATGGGCCCAGG - Intergenic
1127213245 15:56797069-56797091 GGAAAGACACAGATCAAGGTAGG + Intronic
1127417818 15:58774185-58774207 AGAAATGCAAAGATGAGGCCGGG + Intronic
1127829166 15:62735183-62735205 GAAATTTCACAGATGAAGCCTGG - Intronic
1130069983 15:80638895-80638917 GCACATACACAGCAGAAGCCAGG + Intergenic
1130218157 15:81992336-81992358 GGACATTCCCAGATAAAGCCAGG + Intergenic
1130954167 15:88615157-88615179 GAAAAAACACAGACGAGGCCGGG - Intergenic
1131178315 15:90223808-90223830 GGAAATAACCAGATTAACCCAGG - Intronic
1131271726 15:90951465-90951487 GTAAATACTCAAATGAGGCCGGG + Intronic
1131496348 15:92914535-92914557 TAAAATTCACAGCTGAAGCCAGG - Intronic
1134690867 16:16190380-16190402 GGAAAAAGAGAGATGAAGACAGG + Intronic
1135771163 16:25219629-25219651 TGAGATACACAGATGAAGTCAGG - Intronic
1138224786 16:55283427-55283449 GGAAAAACAAAGATGAAAACTGG + Intergenic
1138635225 16:58332969-58332991 TAAAAAACACAGATGCAGCCGGG - Intronic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1139326502 16:66156467-66156489 GGAAATGCACAGCTGCAGTCTGG + Intergenic
1139407636 16:66731572-66731594 GGACATACACAGCTGAAGAAGGG - Intronic
1139693938 16:68659269-68659291 AGAAATAAACACATGAAGGCTGG + Intronic
1142124669 16:88404223-88404245 GGGCAGAGACAGATGAAGCCAGG - Intergenic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1142965864 17:3580719-3580741 AAAAATACACAGTGGAAGCCGGG + Intronic
1143595289 17:7910362-7910384 GGAAATACAGAGATGGAGCCAGG - Intronic
1143656470 17:8296722-8296744 CCAAATACAAAGATGAGGCCAGG + Intergenic
1143656543 17:8297344-8297366 GGAAATACACAAAATGAGCCTGG - Intergenic
1144362735 17:14510543-14510565 GGAAATGCTGAGATGAAACCAGG - Intergenic
1146281655 17:31549165-31549187 GGAAAAACAGAGAGGGAGCCTGG - Intergenic
1146529458 17:33595864-33595886 GGCAAGACACAGCTGAGGCCTGG - Intronic
1146645361 17:34573659-34573681 GGAAAAACACAAAGGAAGCTGGG + Intergenic
1147028132 17:37607491-37607513 GGAAATAAATAGAGGATGCCGGG + Intronic
1147501794 17:40972553-40972575 TGAAACACACAGATGAAGAAAGG - Intergenic
1147648401 17:42048150-42048172 GGAAATACACAAACCCAGCCTGG + Intronic
1147665301 17:42143332-42143354 CGAAATACACAAAGTAAGCCTGG + Intronic
1147911728 17:43860030-43860052 AGAAATGCTAAGATGAAGCCTGG - Intronic
1147988020 17:44317564-44317586 GGAAAAACCAAGGTGAAGCCAGG - Intronic
1148848953 17:50545192-50545214 TGAAAGACACAGATGGAGGCAGG - Intronic
1150357911 17:64504288-64504310 GGAAACATACAGAAGAAGCAAGG - Exonic
1152367778 17:79866646-79866668 AAAAATACACAAATTAAGCCAGG - Intergenic
1153163924 18:2240789-2240811 GGAAAATCACACAAGAAGCCTGG - Intergenic
1155304405 18:24464988-24465010 AGAAAGACACATTTGAAGCCTGG + Intronic
1155951240 18:31915599-31915621 AAAAATACAAAAATGAAGCCGGG + Intronic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1156347086 18:36267234-36267256 GGAAATACATTCATTAAGCCTGG + Intronic
1156989332 18:43388264-43388286 GGAAAGACACAGTTTAAGTCAGG - Intergenic
1157750461 18:50173669-50173691 GGGAAATCACAGATGATGCCTGG + Intronic
1157943204 18:51951552-51951574 AGAAATACCCAGATGAAGGTTGG + Intergenic
1158182548 18:54733370-54733392 GGAAATAATCAGATAAAACCTGG - Intronic
1158413098 18:57224995-57225017 GAAAATACACATTTGAGGCCGGG - Intergenic
1158416927 18:57256921-57256943 GGAAACACCCAGATGATGGCTGG + Intergenic
1159733487 18:72062573-72062595 GGAAATAAACAGATGTAGTCAGG + Intergenic
1160302180 18:77691906-77691928 GGAAATACACAGATGAAATGTGG - Intergenic
1160488599 18:79317845-79317867 GGAAATACCCAGACTGAGCCTGG + Intronic
1160736384 19:664336-664358 AGAAATACACGCATGAGGCCGGG - Intergenic
1162482115 19:10933832-10933854 AGAAATACATATATAAAGCCGGG + Intergenic
1163323459 19:16587921-16587943 GGAAACTTGCAGATGAAGCCAGG + Intronic
1163325717 19:16601871-16601893 GCAAACACACAGCTGAAGCAGGG + Intronic
1163433094 19:17279973-17279995 GGAAATGCAAAAATTAAGCCAGG + Intronic
1164200417 19:23013370-23013392 GGAAGGACCCTGATGAAGCCGGG - Intergenic
1165117465 19:33537522-33537544 GGCAATACAGAAATGGAGCCAGG - Intergenic
1165195276 19:34097633-34097655 GGAAATACACAGGATAAGCCAGG + Intergenic
1165887754 19:39091086-39091108 GGAAATACACAAGAGGAGCCTGG - Intronic
1168382128 19:55932795-55932817 GAAAATACCCAGTTGAGGCCGGG - Intergenic
925616228 2:5746912-5746934 GGATATACTCAGATGAAGAAGGG - Intergenic
926078976 2:9968184-9968206 GGAAAAACACTGACGAAGCTAGG + Intronic
926604367 2:14882395-14882417 TGAAATAGAAAGATGAACCCTGG + Intergenic
927151958 2:20201332-20201354 GCAAATACACAGAGGGACCCTGG + Exonic
927283394 2:21331515-21331537 GAAAATACACAGATAAAGTCTGG - Intergenic
929432661 2:41901584-41901606 GGAAAGAAAAAGATGGAGCCAGG - Intergenic
929622072 2:43365218-43365240 TTAAAAACACAGATGAGGCCAGG - Intronic
929754238 2:44750716-44750738 AGAAATGCAAAGATGAGGCCGGG + Intronic
931945541 2:67302500-67302522 AGAAATACACAAATTAGGCCGGG + Intergenic
932409591 2:71537673-71537695 GGAAATACAAAGAGGAAGAAAGG + Intronic
933041957 2:77480253-77480275 GGAACTACAGAGAAGAAGACTGG + Intronic
934527529 2:95060808-95060830 TGCCACACACAGATGAAGCCAGG + Intergenic
934802788 2:97183283-97183305 GGAAATACACTGAAGAAAACAGG - Intronic
935168073 2:100587078-100587100 GGAAATATACAGGATAAGCCTGG + Intergenic
936907820 2:117557164-117557186 GGAAGTAAACAGATGATGGCAGG + Intergenic
937430358 2:121832800-121832822 GGAAGGAAACAGATGCAGCCAGG + Intergenic
937443580 2:121937597-121937619 TGAAAGATAAAGATGAAGCCAGG + Intergenic
937792607 2:125978477-125978499 GGAAAGACTCAGATGTAGCCAGG - Intergenic
941974563 2:171388956-171388978 GGAAATAGACAGGGAAAGCCAGG - Intronic
942375706 2:175334513-175334535 GGACATACAGTGCTGAAGCCAGG - Intergenic
943815674 2:192250989-192251011 GGTATTACAGAGATGAAGTCTGG + Intergenic
946831078 2:223728618-223728640 GTAAATCCCCAGATGAAGCATGG + Intergenic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
947606221 2:231487542-231487564 GGAACAAAACAGAGGAAGCCTGG + Intergenic
948494849 2:238341016-238341038 AAAAATACACATAAGAAGCCGGG - Intronic
1169205983 20:3740645-3740667 GGAAAGACACACATGACGCAGGG - Intronic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169683314 20:8241910-8241932 GTAAAGGCACAGATGAAGACAGG + Intronic
1170280122 20:14636929-14636951 GGTAAAACACATATGAAGACTGG + Intronic
1170839994 20:19916903-19916925 TCAAATGCACAGATGGAGCCAGG - Intronic
1171032213 20:21687204-21687226 TAAAATACACAGATGAGGCCAGG - Intergenic
1172849625 20:37951845-37951867 GGAAAAGCAAAGATGAATCCAGG - Intergenic
1173625557 20:44470007-44470029 GGAAATATACAAAATAAGCCTGG - Intergenic
1173791452 20:45830438-45830460 GGAAGTAGACAGATGAAGAGAGG - Intronic
1174669620 20:52294274-52294296 GGAAATACCCAGAAGAAGGTGGG + Intergenic
1175596766 20:60240897-60240919 GTAAATACAAACCTGAAGCCGGG + Intergenic
1176217123 20:63953404-63953426 AGAAATACACACAGGCAGCCGGG + Intronic
1176897592 21:14400419-14400441 CGAAAATCACAGATGTAGCCAGG - Intergenic
1179462203 21:41544089-41544111 AGAAATACACAGTTTCAGCCAGG + Intergenic
1180036173 21:45251434-45251456 GCAAGCACAGAGATGAAGCCTGG - Intergenic
1182110742 22:27721432-27721454 GGAAATGCACAGGAGATGCCAGG + Intergenic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1185290662 22:50025369-50025391 ATAAATACACAGAAGAGGCCGGG + Intronic
1185295910 22:50054644-50054666 GCAGATAAACAGATAAAGCCGGG + Intronic
950041330 3:9921151-9921173 GGAAATAGAAAGATGAATCTTGG + Intronic
950096301 3:10332769-10332791 AGAAAGACACTGATGAGGCCAGG - Intronic
951380337 3:21976530-21976552 GGAAATACACAGAAGAGTACAGG + Intronic
951842629 3:27050440-27050462 GCAAATAGATGGATGAAGCCAGG + Intergenic
951874958 3:27413982-27414004 AAAAATACACAGTTGAGGCCAGG + Intronic
953631722 3:44623914-44623936 AGAAATAAACAGAATAAGCCTGG + Intronic
956090556 3:65662040-65662062 AGAAATACAAAGATGAGGCTGGG - Intronic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
956181600 3:66522830-66522852 GGGAGTACAAAGATGAAGACAGG + Intergenic
956357679 3:68412081-68412103 GGATTTACACACATGAGGCCAGG - Intronic
956606505 3:71078125-71078147 GAAAATATACAGAGGAGGCCGGG - Intronic
956706933 3:72007221-72007243 GGAAGTACACAGATGGGGCCAGG - Intergenic
960336861 3:116428117-116428139 GGAAATTCACATAAGAAGGCTGG - Intronic
960495088 3:118363439-118363461 GGAAAGACCCTGATGAAGCTGGG - Intergenic
960576686 3:119237043-119237065 GGAAATCCACACATGAAGCCAGG + Exonic
961610630 3:128134489-128134511 GAAAATACACAGAGGTGGCCAGG + Intronic
963774410 3:149423403-149423425 GGAAATACACAGATGGGCCTAGG + Intergenic
963932200 3:151015020-151015042 AGAAATACGCAGAAGAAGGCTGG - Intergenic
965600596 3:170450657-170450679 AGAAATACAAAAATGCAGCCGGG - Intronic
967784342 3:193474022-193474044 AGAAATACACAGTAGAGGCCAGG + Intronic
969991051 4:11262666-11262688 AGAAATATTCAGATGAGGCCAGG + Intergenic
970442173 4:16090829-16090851 GGAAACGCACAGATGAAAGCTGG - Intergenic
970732656 4:19125270-19125292 GGAAGTCCAAAGATTAAGCCTGG + Intergenic
971176862 4:24290382-24290404 GGATATTCACTGATGAAGCTGGG - Intergenic
971401757 4:26282867-26282889 GGAAATACAGAGTTGAGTCCAGG + Intronic
971979856 4:33737820-33737842 TGAAATACACAGACTAAGCCTGG + Intergenic
972168716 4:36318907-36318929 GAAAATGCACAGAAGAGGCCAGG - Intronic
972209481 4:36820127-36820149 GGAAGTACATATATGAAGACAGG + Intergenic
972295256 4:37731591-37731613 GGAAATATACAGATTGATCCTGG + Intergenic
973049491 4:45577281-45577303 GGAAATATACAGATGAACCGGGG + Intergenic
974875169 4:67694690-67694712 AGAAATACAAAGATGTGGCCAGG - Intronic
976448374 4:85158622-85158644 GGAAATACAGACATGATGACAGG - Intergenic
976459742 4:85296012-85296034 GGACCTACACAGTTGAAACCTGG - Intergenic
977238374 4:94536291-94536313 GCTAATACACAGATGTGGCCAGG - Intronic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
979322401 4:119339637-119339659 GGAAACACACAGGAGAAGCTAGG - Intergenic
980933019 4:139199413-139199435 GGAAGTACACAGATGAGCCTAGG - Intergenic
981257384 4:142678108-142678130 AGAAATACAAATATGAAGGCAGG + Intronic
981404627 4:144353796-144353818 AGAAATACACAGATGTAGACGGG + Intergenic
981851952 4:149241635-149241657 TTAAATAAACAGATGAGGCCGGG - Intergenic
982304370 4:153914677-153914699 GAAAATTCACAGAGGAACCCTGG - Intergenic
983240379 4:165225251-165225273 GGAAACACACAGGAGAAGCTAGG - Intronic
984389702 4:179113154-179113176 GGAAAAACACAGATATAGACAGG + Intergenic
984765230 4:183395368-183395390 GGAAAAACAAAGGTGAAACCAGG - Intergenic
985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG + Intronic
985998558 5:3611998-3612020 GGAAATACATAGATGTGGTCAGG + Intergenic
988404371 5:30805138-30805160 GGCAAGACACAGCTGAATCCAGG + Intergenic
994671265 5:102764425-102764447 GCAAAAACCCAGATGAAGTCGGG + Intronic
995799520 5:115978929-115978951 GGAAAAACACTGAAGAATCCAGG - Intronic
996489264 5:124073474-124073496 TAAAACACACAGATGCAGCCTGG - Intergenic
996697430 5:126414134-126414156 GGAAATACAGCTAAGAAGCCAGG + Intronic
996708876 5:126524241-126524263 GCAAATAAACAGAACAAGCCAGG - Intergenic
998357124 5:141548428-141548450 GGAAATACAAAAATGTAGACAGG + Intronic
1001155308 5:169267748-169267770 GGAAATACTCATATGGGGCCTGG + Intronic
1005106569 6:22230166-22230188 GAAAATACTCAAATGAAGGCAGG - Intergenic
1005614694 6:27561355-27561377 AGAAATACAAAGCTGGAGCCGGG - Intergenic
1005903857 6:30243339-30243361 AAAAATACAAAAATGAAGCCGGG + Intergenic
1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG + Intronic
1006453355 6:34118099-34118121 GGAAATACACACATGTATCAAGG + Intronic
1007432020 6:41781992-41782014 GGTAAGACAAAGATGAAACCAGG - Intronic
1009401386 6:63260107-63260129 AGAAATGCACAGAAGAGGCCGGG - Intergenic
1009996526 6:70901404-70901426 GGAAATACACAAGATAAGCCTGG + Intronic
1011684273 6:89811852-89811874 GAAAATACAAAGGTGTAGCCAGG - Intronic
1012455157 6:99395304-99395326 GAAAATACAAAAATTAAGCCGGG - Intergenic
1012532736 6:100257922-100257944 TGAAATAAACAGCTGAAGTCAGG - Intergenic
1012998811 6:106000142-106000164 TGAAATACATAGATAATGCCAGG - Intergenic
1013052879 6:106554315-106554337 TCAAATACACAGATGGAGGCCGG + Intronic
1014618554 6:123636143-123636165 GGAAATTCAGAGATAAAGACTGG - Intronic
1015334157 6:132017181-132017203 GGATATATACAAATGTAGCCAGG - Intergenic
1016448371 6:144155803-144155825 TGAAATACACAGATAATGTCTGG - Intronic
1017632063 6:156405943-156405965 GGAAATACACAAGAGCAGCCTGG + Intergenic
1017690125 6:156955940-156955962 GCAGATACACAGATGAACACAGG - Intronic
1018722871 6:166587057-166587079 GGAGCTACAAAGAAGAAGCCTGG + Intronic
1019508915 7:1407511-1407533 TTAAATACACAGATTTAGCCAGG - Intergenic
1019638772 7:2091184-2091206 GGAAATACACAGGAGGAGCCTGG - Intronic
1021829912 7:24595340-24595362 GGAAATACAAATCTGAAGCTTGG + Intronic
1022875532 7:34524552-34524574 GCAACAACACGGATGAAGCCGGG - Intergenic
1022963497 7:35452259-35452281 GGAAATACACAGGATAAACCTGG + Intergenic
1023866476 7:44240754-44240776 GGAGAGACACAGATAAAACCGGG + Intronic
1023878629 7:44306479-44306501 ATAAATACAGAGATGAAGACAGG + Intronic
1024470878 7:49768039-49768061 GGATATACACAGAGCAGGCCTGG - Intergenic
1024894557 7:54242987-54243009 GGAAATAACCTGATGAAGCTTGG + Intergenic
1026069833 7:67108976-67108998 GAAAATATACTGATGAGGCCGGG + Intronic
1029265042 7:99332057-99332079 GGAAATAAACAGTTAAAGCCAGG - Intronic
1030195842 7:106852708-106852730 GGAAATAATCCGAGGAAGCCTGG - Intergenic
1031307868 7:120155600-120155622 GGAAATACACAAAATTAGCCTGG - Intergenic
1033808578 7:144982900-144982922 GGAAATACACAAGATAAGCCTGG - Intergenic
1033810564 7:145006221-145006243 GGGAATACACAGAAGAACCTTGG - Intergenic
1034533586 7:151712776-151712798 GGAAAGACAGAGATGGAGGCTGG - Intronic
1034848484 7:154470953-154470975 CGAAAAACACAGCTGCAGCCGGG + Intronic
1037282244 8:17255070-17255092 GGAAATACAGAGATGAATATGGG - Intronic
1039438839 8:37580570-37580592 GGCACTACAGAGATGAAGCAAGG + Intergenic
1040576989 8:48661212-48661234 AGAAATACACAGTATAAGCCAGG - Intergenic
1040810075 8:51441904-51441926 AATAATACACACATGAAGCCTGG + Intronic
1041449123 8:57988794-57988816 GGAAATACCCAGGTGGAGCCAGG + Intergenic
1042584307 8:70318329-70318351 GGAAGTACACAGATGAGCCTAGG - Intronic
1044431409 8:92111990-92112012 GAAAATACAGACATGAAGCCAGG - Intergenic
1045628463 8:104085918-104085940 GGAAATACAGATCTGAAGCTTGG + Intronic
1045726043 8:105174883-105174905 GGAGAGACACACAAGAAGCCAGG + Intronic
1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG + Intronic
1048155090 8:131939866-131939888 GGACAAACTCAGATGAAGGCAGG - Intronic
1048856788 8:138693225-138693247 CCAAACACACAGATGCAGCCAGG - Intronic
1050245072 9:3680863-3680885 TGAAAGACACAGAGGAAACCAGG + Intergenic
1051746545 9:20300075-20300097 GTAAATACACAGATGATGGTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053393892 9:37754933-37754955 GGAAATACAAAGGTGCTGCCAGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055829866 9:80365598-80365620 TGCAATAAACTGATGAAGCCTGG + Intergenic
1056409761 9:86313343-86313365 GGGAATACACAGAAGAAGCAAGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057458147 9:95233345-95233367 TGAAATTCAGAGATGAGGCCAGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058145625 9:101407891-101407913 GGAAATACAAAGATCAACCAAGG - Intronic
1059558271 9:115304858-115304880 GGAAATTCCCAGATGAATCAAGG + Intronic
1059913543 9:119073941-119073963 AGAAATACACAGATGTAGATAGG + Intergenic
1060564924 9:124582262-124582284 GCAAGGACACAGATGAAGCTGGG + Intronic
1061027105 9:128056817-128056839 GGAAATACAAAAATTAGGCCAGG - Intergenic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1189526118 X:41823738-41823760 GGAAAGAGACAGAGGAAACCAGG - Intronic
1190154783 X:47981253-47981275 GGAAATATACAAAAGGAGCCTGG + Intronic
1192247988 X:69389021-69389043 AGAAATACTCAGCTGAAGCCAGG + Intergenic
1193363802 X:80606830-80606852 GGAAATACAAACAAGAAACCTGG + Intergenic
1195307611 X:103600710-103600732 GAAAATAAAAAGATGAAGGCAGG - Intergenic
1195640739 X:107172026-107172048 AGAAATAAAAAGATGAGGCCAGG + Intronic
1196917920 X:120557999-120558021 AAAACTACACAGATGAAACCTGG - Exonic
1198097410 X:133393537-133393559 GGAAATACGAAGTTGAACCCAGG - Intronic
1198476004 X:136998983-136999005 GGAAAAAGACAGGTGGAGCCTGG + Intergenic
1198562760 X:137868662-137868684 GGAAAAACACAGAGGAAACAAGG + Intergenic