ID: 956179085

View in Genome Browser
Species Human (GRCh38)
Location 3:66500924-66500946
Sequence GCGCGCGCGCGCGCGCTCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 16, 3: 59, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956179085_956179088 -4 Left 956179085 3:66500924-66500946 CCAGAGAGCGCGCGCGCGCGCGC 0: 1
1: 0
2: 16
3: 59
4: 255
Right 956179088 3:66500943-66500965 GCGCAGCCTCGGGTTCCGCACGG 0: 1
1: 0
2: 0
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956179085 Original CRISPR GCGCGCGCGCGCGCGCTCTC TGG (reversed) Exonic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
901934453 1:12618045-12618067 TCGCGCGCGCTCGCTCGCTCCGG + Intergenic
902348428 1:15835918-15835940 GCGCGCGCGCGCTCGCCGTGCGG + Intergenic
903034514 1:20485566-20485588 GCGCAGCCGCGGGCGCTCTCCGG - Exonic
904181376 1:28668918-28668940 GCGCGCCCGCCCGCCCTCGCCGG - Intronic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
906204337 1:43979183-43979205 GCGCGCGCGGGCGCGCGGGCCGG + Intronic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
912993506 1:114511202-114511224 GCGTGCGCGCGCGCTCTCGTTGG - Intergenic
913714476 1:121519664-121519686 GCTCGCGCTCCCGCGCTCTTTGG + Intergenic
915142334 1:153775367-153775389 GCCAGCGCACGCGCGCTCCCTGG + Exonic
917974790 1:180231547-180231569 GCGCGCGCGCGCGCGACGACTGG - Intronic
918332503 1:183472910-183472932 GCGCGCGCGCCCTTGGTCTCGGG + Intronic
918601977 1:186375145-186375167 GCTCGCGCGCGCCCGCCCGCCGG + Exonic
919638709 1:200029247-200029269 GCGCCCGCGCGGGCGGTCTTGGG + Intronic
920600599 1:207320870-207320892 GCGCGCGCGCGCGCGCCTCGGGG - Intergenic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
922831531 1:228556784-228556806 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832009 1:228608738-228608760 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832570 1:228610979-228611001 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833130 1:228613220-228613242 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833691 1:228615461-228615483 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922834250 1:228617702-228617724 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835359 1:228622158-228622180 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835918 1:228624378-228624400 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922836477 1:228626620-228626642 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837035 1:228628859-228628881 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837594 1:228631101-228631123 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838153 1:228633342-228633364 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838712 1:228635581-228635603 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922839270 1:228637807-228637829 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922840392 1:228642279-228642301 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
923191709 1:231626668-231626690 GCGCGCGCGCGCGCGCGTCAGGG + Intronic
1065214697 10:23438876-23438898 GCGCGCGAGCGCGCGCGGGCGGG - Intergenic
1067091336 10:43267024-43267046 GCTCGCTCGCTCGCGCTCCCCGG - Intergenic
1068953863 10:62804839-62804861 GCGTGCGCGTGCGCGCTCAGAGG + Exonic
1069403632 10:68075352-68075374 GGGCTCGCGCGCGTGCTCTGCGG - Intergenic
1069662495 10:70132743-70132765 GCGCCCGCGCGCTCTCGCTCCGG + Exonic
1069913597 10:71774032-71774054 GTGCGCGCGCGCATGCACTCAGG - Intronic
1070796752 10:79221411-79221433 GCCCGCGCACGTGCGCTCTGAGG - Intronic
1071086828 10:81875248-81875270 GCGGGCGCGGGCGCGGGCTCCGG - Intergenic
1071529281 10:86376919-86376941 GCGGGCGCGCGCGGCCTCTGGGG - Intergenic
1072021826 10:91410250-91410272 GCGCGCGCGGGGGCGGCCTCGGG + Intergenic
1072994194 10:100228970-100228992 GCGCGCGCGCGCGCGCTTGGAGG - Intronic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1076707289 10:132308643-132308665 GCACGTGCGCCCGCGCTCTCGGG + Intronic
1077053162 11:576727-576749 GCGGGCGGGCGCGCGCGCGCTGG + Intronic
1077053164 11:576731-576753 GCGGGCGCGCGCGCGCTGGGAGG + Intronic
1077076892 11:706095-706117 CCGCGCGCCCGCCCGCTCTCGGG + Exonic
1077201510 11:1309698-1309720 TCGCGCGCACGCGCGCTCCAGGG + Intergenic
1080866443 11:36199597-36199619 GCGTGCGCGCACACGCTTTCTGG + Intronic
1081488271 11:43547938-43547960 GCCCCCGCGCGGGAGCTCTCGGG + Intergenic
1083657104 11:64234904-64234926 GGGCGGGCGGGCGCGCTGTCGGG - Intronic
1087003831 11:93449027-93449049 GTGCGCGCGTGCGCGCTCCTCGG + Intergenic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1087782637 11:102317631-102317653 GCGCGCGCGCGCGCCTCCCCTGG + Intronic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1088820485 11:113452474-113452496 GCGCGCGCGCGCGCACATTGGGG + Intronic
1089397595 11:118146052-118146074 GCCCCCGCGCGCGTGCACTCGGG - Intronic
1089713671 11:120336325-120336347 GCGGGCGCGCGCGCGGGTTCCGG - Intergenic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1092196967 12:6555540-6555562 GGGCTCGCCCGCGCGCTCCCCGG - Exonic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG + Exonic
1094041710 12:26126101-26126123 GGGCGAGCGCGCGCGCGCACGGG - Intronic
1095799390 12:46256594-46256616 GTGCGCGCGCGCGCGCAAACTGG - Intronic
1096101296 12:48971832-48971854 GCGCGCGCGCGCGCGCTGGGAGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096255045 12:50057707-50057729 GCCCGCGCGCGCTGGCTCGCTGG - Exonic
1096482395 12:51951536-51951558 GCGGGCGCCCGCGCGCGCCCCGG + Intergenic
1096482447 12:51951678-51951700 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
1096994616 12:55830810-55830832 GCGCGCGCGTGCGCGCGGTGGGG - Intronic
1096994618 12:55830812-55830834 GCGCGCGCGCGTGCGCGCGGTGG - Intronic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1101354716 12:103966119-103966141 TGGCGCGCGCGCGCGCACGCAGG + Intronic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1102084395 12:110124283-110124305 GCGCGCGCGCGCACGAGCTGGGG - Intergenic
1103758817 12:123233134-123233156 GGGCGCGCGCGCGCTCCCTCGGG - Exonic
1103779297 12:123388862-123388884 GCGCCCGCCCGCCCGCCCTCCGG + Intronic
1104568285 12:129903899-129903921 GCTCGGGCGCGCGCGCGCTCCGG + Intergenic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1110860367 13:80340356-80340378 CCCCGCGCGCCCGCGCTCTAGGG - Intronic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113655609 13:112066666-112066688 GCCGCCGCGCGCGCGCGCTCAGG + Intergenic
1113737709 13:112690157-112690179 GGGGCCGCGCGCGCGCGCTCTGG - Intergenic
1114602787 14:23969830-23969852 GCGCCAGCCCGCGGGCTCTCAGG + Intergenic
1114607155 14:24006959-24006981 GCGCCAGCCCGCGGGCTCTCAGG + Intergenic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1117899253 14:60515578-60515600 GCGCGCGCCCGCCCACCCTCGGG + Intergenic
1118404818 14:65412796-65412818 GCGCGTGCGCGCGTTATCTCCGG + Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1120881057 14:89416116-89416138 GCGCGCGCGCGCGTGCTGGGTGG - Intronic
1120881059 14:89416120-89416142 GCGTGCGCGCGCGCGCGTGCTGG - Intronic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1124696929 15:31870935-31870957 GCGCGCCCGCGAGCCCGCTCCGG + Intergenic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129483074 15:75843280-75843302 GCGGCCGGGCGCGCGCGCTCTGG + Exonic
1129644848 15:77420259-77420281 GTGAGCACGCGCGCGCTCACGGG + Intergenic
1130225318 15:82052938-82052960 GCGCGCGTGCGCGCGCAGTGAGG - Intergenic
1130849322 15:87778448-87778470 GCGCGCGCGCGCGTGCACACAGG - Intergenic
1132055548 15:98648510-98648532 TCGCGCGCGCGCGCGCGCCCTGG - Intergenic
1132591502 16:728230-728252 GCGGGTGAGCGCGCGCTCCCGGG + Exonic
1132926008 16:2429427-2429449 CGGGGCGCGGGCGCGCTCTCAGG + Exonic
1133232195 16:4372077-4372099 GCGCGCACACACGCACTCTCGGG + Intronic
1133340664 16:5033668-5033690 GCGCGCGCGCGCGCCTCCCCCGG - Exonic
1133513442 16:6483296-6483318 GCTCTCGCGCCCGCGCGCTCGGG + Intronic
1134131027 16:11650369-11650391 GCGCGCGCGCGCGCTGTCCATGG - Intergenic
1138243465 16:55447406-55447428 GCGCGCGCGTGCACGCTCATGGG - Intronic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1139754651 16:69132617-69132639 CCACGTGCGCGCGCGCTCTCAGG - Exonic
1140187406 16:72787657-72787679 GCGTGCGAGAGCGCGCTCTGTGG - Exonic
1140225123 16:73070909-73070931 GCGCGCGCGCGCGCGCAAGACGG - Intergenic
1140462248 16:75148961-75148983 TCCCGCGCGCGCGCGCCCGCCGG - Intronic
1140613808 16:76634972-76634994 GCCCGCGCGCAGGCGCACTCCGG - Intronic
1141694456 16:85613091-85613113 GCGCGCGCGCGCGCACCGACGGG - Intronic
1144991568 17:19237351-19237373 GGACGCGTGCGCGCGCCCTCAGG - Exonic
1146033919 17:29390225-29390247 GCGCGCGCGCGCGCCCTCACAGG - Intergenic
1146053316 17:29568695-29568717 GGGCGCGCGCGCTCCCTCGCTGG + Exonic
1147612813 17:41811738-41811760 GCGCGAGAGCGCGCGCTACCTGG - Exonic
1148284058 17:46372676-46372698 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148284060 17:46372681-46372703 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1148306279 17:46590597-46590619 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148306281 17:46590602-46590624 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1149840976 17:59964739-59964761 GCGGCGGCGCGCGCGCTCCCCGG + Intronic
1152745607 17:82037300-82037322 GCGCCCGCGCACCCTCTCTCGGG - Intronic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1154266517 18:12883704-12883726 GCGCTCGGGCGCGCGCCCCCGGG - Intronic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1160895879 19:1401581-1401603 GCGCGCGCGCGTCCTCTCGCGGG - Intergenic
1161572001 19:5035887-5035909 GCGCGCGCGCCTGCGCGCACAGG + Intronic
1161802585 19:6424402-6424424 GCTCGCGCGCGCGCGCAGGCGGG - Intronic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1162584513 19:11550912-11550934 GCGCGCGCGCATTGGCTCTCTGG - Intergenic
1163154523 19:15432606-15432628 CCCCGCGGGCGCGCGCTCCCGGG + Intronic
1163369810 19:16895878-16895900 GCGCGCGCGCGCGCGCATACGGG - Intronic
1163681164 19:18683495-18683517 GCGCGCCCAGGCGCGCGCTCGGG - Intergenic
1164658572 19:29942447-29942469 GCGCCCGCGCGCCCGCCCTCAGG - Exonic
1165129191 19:33621769-33621791 CCGCGCCCACGCGCGCTCTGCGG - Intergenic
1165812307 19:38618888-38618910 GCGTGCGCGCGCGAACTCACCGG - Intergenic
1166975052 19:46601104-46601126 GCGAGCGCGCGCGCGCCCGGCGG + Intronic
1167079947 19:47271745-47271767 GCGCGCGCGCGCGCGCTAGAGGG + Exonic
1168076437 19:53982879-53982901 GCGCGCCCGCGCACGCGCCCCGG - Exonic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926020184 2:9487836-9487858 GCGCGCGCGCGCGCGCTGTGGGG + Intronic
926923576 2:17963770-17963792 GTGCGCGCGCGCGCGCGTCCAGG + Intronic
928093590 2:28391122-28391144 GCGCACGCGCGCGCGTCCTTGGG + Intergenic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929776644 2:44934626-44934648 AGGCGCGCGCGCGCGCTTGCGGG - Intergenic
929788678 2:45009131-45009153 CCGCCCGCGCGCGCCCTCACCGG + Exonic
930872692 2:56184415-56184437 GCGCGCGCCCGCGCTCCCCCAGG - Exonic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
933724435 2:85418650-85418672 ACGCGCGCGCGCGCGCCTTTTGG + Intergenic
936141687 2:109947195-109947217 GAGGGCGCGCGCCCCCTCTCGGG + Intergenic
936178375 2:110245143-110245165 GAGGGCGCGCGCCCCCTCTCGGG + Intergenic
936203003 2:110424289-110424311 GAGGGCGCGCGCCCCCTCTCGGG - Intronic
938035160 2:128028652-128028674 GCGCACCTGCGCGCGCTTTCCGG + Intergenic
939153808 2:138501762-138501784 CCGCGCGCACGCGCCCTCGCGGG + Intergenic
941686921 2:168456670-168456692 GCACACACTCGCGCGCTCTCTGG + Intronic
941951329 2:171160257-171160279 CCGCGCCCGCGCCCGCTCGCGGG - Intronic
942314093 2:174682585-174682607 GGGCGCGGGCGCGCGGCCTCGGG - Intronic
943658581 2:190534509-190534531 GCGCGTGCGTGCTCGCTCCCCGG - Intronic
944675548 2:202032656-202032678 GGGCGCTCGCGCGCGCTCTCTGG - Intergenic
944683637 2:202098818-202098840 GTGCACGCGCGCGCGCGCGCAGG + Intronic
944766645 2:202871470-202871492 GCGCGCGCGCGCGGCTTCTCGGG - Exonic
945033360 2:205684942-205684964 GCGCGCGAGCGCGCACACACTGG + Intronic
945119469 2:206443422-206443444 CCCCGCTCGGGCGCGCTCTCGGG + Intergenic
945203696 2:207310047-207310069 GTGCGCGCGCGCGCGCACGCAGG - Intergenic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
945699442 2:213151857-213151879 GCGCGCGCGCGCGGGCTGGCGGG + Intronic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
947792548 2:232876464-232876486 GCGCGCGCAGGCGAGCGCTCAGG + Intronic
948467389 2:238158896-238158918 GCGGGCGGGCGCGCGGTCTCGGG + Intergenic
1169278434 20:4248722-4248744 CCGCCCGCGCCCGCGCTCCCCGG + Exonic
1169758873 20:9069291-9069313 GTGCGCGCGCGCGCGCGTCCGGG - Intronic
1170226461 20:13995963-13995985 GCGCACACTCGCGCGCACTCCGG + Intronic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174386794 20:50192115-50192137 GCGCGGGCGCGGGCGCTCCCCGG - Exonic
1174467865 20:50731430-50731452 GTGCGCGCGCGCGGGCTCGCGGG + Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1177077011 21:16588641-16588663 GCGAGCACGCGCGCGCACACAGG - Intergenic
1177077013 21:16588646-16588668 GTGCGCGCGCGTGCTCGCTCGGG + Intergenic
1178457812 21:32771735-32771757 GACGGCGCACGCGCGCTCTCCGG + Exonic
1178708196 21:34890784-34890806 GCGCGCGCCCGCCCGCCCGCAGG + Intronic
1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG + Intergenic
1179526729 21:41982729-41982751 GCGCGCGCTCGCTCACTCTCAGG - Intergenic
1180101600 21:45590344-45590366 GCGCGCGGCCGCCCGCTCCCAGG + Intergenic
1180951705 22:19723421-19723443 GCGCGCGTCCGCGCGGCCTCTGG + Exonic
1181413296 22:22740185-22740207 GCGCGTGCGCGCGCGCTCTTTGG - Intronic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1183504736 22:38202713-38202735 GTGTCCGCGCGCGCGCTCCCTGG + Intronic
1183544849 22:38449943-38449965 GCGCGCACACGGGCGCTCACGGG - Intronic
1185255202 22:49827757-49827779 GCGCCCGCGCCCGCGCCCGCCGG - Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
950586379 3:13895352-13895374 GCCCGCGCGCTCGCCCTCTTTGG - Intergenic
951558860 3:23946027-23946049 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
955387620 3:58492100-58492122 GTCCCCGCGCTCGCGCTCTCCGG + Intronic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
956825872 3:72996723-72996745 TCGGCCGCGCACGCGCTCTCGGG + Intronic
958641784 3:96814560-96814582 TTGCGCGCGCGCGCTCTCTCCGG + Intronic
961144852 3:124585081-124585103 GCGAGCGCGCGCGTTCTGTCTGG - Intronic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966449063 3:180037087-180037109 GGGCACGCGCGCGCGTTCCCAGG + Intergenic
966592230 3:181695790-181695812 ACGCGCGCGCGCGCGTTCTCGGG + Intergenic
968178192 3:196569048-196569070 GCGGGCGCGGGCGCGGGCTCGGG + Exonic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
970332634 4:15002298-15002320 GAGGGCGCGCTCGCGCTCCCGGG - Intergenic
972499494 4:39664219-39664241 GCGCGCGCGCGCGCGCATGACGG + Intergenic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
977184353 4:93917808-93917830 GCGCGCGCGCGCTCTAGCTCTGG + Intergenic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
977908465 4:102502369-102502391 GCGCGCGCGCGCGCGCACGGAGG - Intronic
978645785 4:110929711-110929733 GCGCGCGCGCGTGTACACTCAGG + Intergenic
984024119 4:174522525-174522547 GCGCGCGCGCGCGTGCAGCCCGG + Exonic
984260867 4:177442462-177442484 GCGCCCACGCCCGCTCTCTCGGG + Exonic
985005866 4:185535230-185535252 GCCCGCCCTCGCGCGCTTTCTGG + Intronic
985629863 5:1008784-1008806 GCGCGGGCGCACGCGCTCAGAGG + Intergenic
985897406 5:2756870-2756892 ACGCGCGCGCTCGCGCTTCCCGG + Intergenic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
987303420 5:16617006-16617028 GCGCGCGCGCGGGCGCGCCTGGG + Exonic
989178907 5:38556769-38556791 GCGCGCGCGGGCGCGCGGCCGGG - Intronic
993500513 5:88661045-88661067 GCGCCGGCGCGCGCGCTCCCGGG - Intergenic
993919146 5:93779125-93779147 GCGCGCGCGCGCGCACGTGCAGG + Intronic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
999239131 5:150117521-150117543 GCGCGCGCGCGCGCGCTGCCAGG - Intronic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1001906576 5:175478515-175478537 GCGCGCGCGAGGACGCGCTCCGG + Exonic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002521759 5:179796267-179796289 ACGCGAGCGCGCGCGCCCTCTGG + Exonic
1002710462 5:181191966-181191988 GCGCGCGGGCGGGAGCTGTCGGG + Intergenic
1004069728 6:12287754-12287776 AGGCGCGCGCGCGCGCGCGCAGG + Intergenic
1004396163 6:15248271-15248293 GCGCGCGCGCGCGGCCTATAGGG + Intronic
1004720445 6:18264216-18264238 GGGCGGGCGCGCGCGCACGCGGG - Intronic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1005871425 6:29976715-29976737 GGGCGCCCGAGCGCGTTCTCAGG + Intergenic
1006125373 6:31834555-31834577 GCGCGCGCCCGCGCGCGCGCGGG + Intergenic
1006271984 6:32972075-32972097 GCGCGCGCGCTCGCTCACGCGGG - Exonic
1011277200 6:85642968-85642990 GCGGGGGCGCGCGCGCGCACCGG - Exonic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1013369109 6:109455064-109455086 GCGCCCGGGCGCGCTCTCCCAGG + Intronic
1015149141 6:130019422-130019444 CCGCCCGCTCGCTCGCTCTCCGG - Intronic
1015315064 6:131808076-131808098 GCGAGGGCGGGCGCGCTCCCCGG + Exonic
1017163830 6:151390435-151390457 GCGAGCGCGCGCGCGCACGCGGG - Intronic
1017913944 6:158818370-158818392 GGGCGCGCGCCCCCGCTCTCGGG - Intronic
1018329954 6:162716751-162716773 GCGTGCGCGCGCGCGCAGGCGGG - Intronic
1020066218 7:5190370-5190392 CCTCGCGCGCGCGCCCTCCCCGG + Exonic
1020281870 7:6653970-6653992 GCGCACGGGCGCGCGCACACCGG + Exonic
1022133305 7:27424004-27424026 GCGCGCGTGCGCGTGCACTTGGG - Intergenic
1023447680 7:40248869-40248891 GTGCGAGCGCGCGCGCGCGCTGG - Intronic
1023955730 7:44885383-44885405 GCGCTCGCGCCCCCGCCCTCCGG + Intergenic
1023972157 7:44999803-44999825 GCGCGCGCGGGAGCGCGCGCGGG - Intronic
1027592553 7:80134746-80134768 ACGTGCGCGGGCGCGCGCTCTGG + Intronic
1030394492 7:108968546-108968568 GTGCGCGCGCGCGCACTATTTGG + Intergenic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1031532026 7:122886779-122886801 GCGCGCGCACGCGCACTCCGCGG - Intergenic
1033927025 7:146474982-146475004 GCGCGTGCGCGCTCGTGCTCAGG - Intronic
1034343585 7:150372499-150372521 GCGCACTCGCGCGTGCACTCCGG + Exonic
1037878413 8:22560873-22560895 GCGCGCGCGCACGCGCCGTGGGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1038554014 8:28494170-28494192 GCGCTCGTGAGCTCGCTCTCCGG + Intergenic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1038767911 8:30446845-30446867 GCGCGCGCGCGCGCGGTGGAGGG + Intronic
1041708044 8:60867425-60867447 ACGCGCGCACGCACGGTCTCAGG + Exonic
1043173998 8:77000724-77000746 GCGCGCGCTGGCCCGCTCTACGG - Intronic
1043464708 8:80493186-80493208 GCGCGCGCGCGCGCGTTTTGAGG - Intronic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1045327246 8:101126513-101126535 GCGCTCGCACGCGCCCTCCCAGG + Intergenic
1047499354 8:125430067-125430089 GCGCCCGAGCGCGCGCTGCCCGG + Intergenic
1049532288 8:143160465-143160487 GCTGGCGCGCGCGCTCCCTCGGG + Intronic
1050437853 9:5628956-5628978 GAGGGCCCGCGCGCGCGCTCTGG - Intergenic
1050437854 9:5628961-5628983 GCGCGCGCGCGGGCCCTCCCCGG + Intergenic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1054842663 9:69760020-69760042 GCGCGCGCGCGCGGGTGCTTCGG + Intergenic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1055308361 9:74952896-74952918 GTGCGCGCGCGCACTCTGTCTGG + Intergenic
1055945860 9:81690024-81690046 GCGCGCGGGCGCGCGCTAGCGGG + Intergenic
1056167945 9:83956763-83956785 GCCCTCTCGGGCGCGCTCTCAGG + Intronic
1056732494 9:89178176-89178198 CCGCGCGCCCGCCCGCTCCCGGG + Exonic
1056985573 9:91361573-91361595 GCGGGCGGCCGCTCGCTCTCAGG - Intronic
1057600032 9:96450077-96450099 GCGCACCCGCGCGCGCTGACTGG + Intergenic
1057995914 9:99821683-99821705 GCGCGCGCGCGCGCGTTCCTCGG - Intergenic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1061190779 9:129081408-129081430 GCGCTCGCTCGCGCACTCTGCGG + Intronic
1061875079 9:133539591-133539613 GCGCGCTCCCATGCGCTCTCAGG - Intronic
1062341433 9:136095379-136095401 GGCCGCGCGCGCGCGCGCACTGG + Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1187067551 X:15855069-15855091 GCGCGGGCGCGCGGGCGCTCGGG - Intergenic
1187067555 X:15855080-15855102 GCGCGCCCGCGCGCTCTTGCAGG + Intergenic
1187675770 X:21715310-21715332 ACGCGCGCGCGCTCGCGCGCTGG + Intronic
1187675772 X:21715314-21715336 GCGCGCGCTCGCGCGCTGGTGGG + Intronic
1189528580 X:41854193-41854215 GCGCGCGCGCGCATGTTCCCTGG - Intronic
1190862635 X:54358648-54358670 GCCCCCGCGCGCGCGCACTGCGG - Intergenic
1195625184 X:106999833-106999855 GCGCGCGCGTCCGCCCCCTCGGG + Intronic
1198517483 X:137424656-137424678 GCGCGCCCGCGCGCGTTCGCGGG - Intergenic
1199445035 X:147911783-147911805 GCGCGCATGCGCGCGCTCCCAGG + Intergenic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1200233540 X:154457985-154458007 GCGCGGGCGCGCGCGGGTTCCGG + Intergenic