ID: 956183057

View in Genome Browser
Species Human (GRCh38)
Location 3:66535218-66535240
Sequence TGGGAGGATCGCTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102195
Summary {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956183057_956183062 -1 Left 956183057 3:66535218-66535240 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 956183062 3:66535240-66535262 ACCTCGGCCCCCAAAATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956183057 Original CRISPR TGGGAGGATCGCTGAAGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr