ID: 956183265

View in Genome Browser
Species Human (GRCh38)
Location 3:66537270-66537292
Sequence GCAGCAGTTTATACCCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956183264_956183265 28 Left 956183264 3:66537219-66537241 CCTTTTTGTTTTTGTTTTTGTTG No data
Right 956183265 3:66537270-66537292 GCAGCAGTTTATACCCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956183265 Original CRISPR GCAGCAGTTTATACCCAGAG CGG Intergenic
No off target data available for this crispr