ID: 956185161

View in Genome Browser
Species Human (GRCh38)
Location 3:66555527-66555549
Sequence ATGTTTTACCAGAAGCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956185157_956185161 8 Left 956185157 3:66555496-66555518 CCTTTCCTAGTTTCTTTTGTTGT No data
Right 956185161 3:66555527-66555549 ATGTTTTACCAGAAGCCAAGAGG No data
956185158_956185161 3 Left 956185158 3:66555501-66555523 CCTAGTTTCTTTTGTTGTATATG No data
Right 956185161 3:66555527-66555549 ATGTTTTACCAGAAGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956185161 Original CRISPR ATGTTTTACCAGAAGCCAAG AGG Intergenic
No off target data available for this crispr