ID: 956192443

View in Genome Browser
Species Human (GRCh38)
Location 3:66620692-66620714
Sequence CAGCCCAACTGCCAGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956192443_956192448 3 Left 956192443 3:66620692-66620714 CCCAGGGCCTGGCAGTTGGGCTG No data
Right 956192448 3:66620718-66620740 TTTCAGCTGCCAAAAATTTTGGG No data
956192443_956192447 2 Left 956192443 3:66620692-66620714 CCCAGGGCCTGGCAGTTGGGCTG No data
Right 956192447 3:66620717-66620739 GTTTCAGCTGCCAAAAATTTTGG No data
956192443_956192451 30 Left 956192443 3:66620692-66620714 CCCAGGGCCTGGCAGTTGGGCTG No data
Right 956192451 3:66620745-66620767 ACATAGAATATTCCCAAGATGGG No data
956192443_956192450 29 Left 956192443 3:66620692-66620714 CCCAGGGCCTGGCAGTTGGGCTG No data
Right 956192450 3:66620744-66620766 CACATAGAATATTCCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956192443 Original CRISPR CAGCCCAACTGCCAGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr