ID: 956196902

View in Genome Browser
Species Human (GRCh38)
Location 3:66662021-66662043
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956196902_956196907 18 Left 956196902 3:66662021-66662043 CCCATGGAGAACCCTGCAGTGTG No data
Right 956196907 3:66662062-66662084 TGTTCCATCTTGAGGCACGAAGG No data
956196902_956196906 10 Left 956196902 3:66662021-66662043 CCCATGGAGAACCCTGCAGTGTG No data
Right 956196906 3:66662054-66662076 ACAGAATTTGTTCCATCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956196902 Original CRISPR CACACTGCAGGGTTCTCCAT GGG (reversed) Intergenic