ID: 956198918

View in Genome Browser
Species Human (GRCh38)
Location 3:66684731-66684753
Sequence GGGTGGTGATCCCAAGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956198918_956198920 -8 Left 956198918 3:66684731-66684753 CCACTCTCTTGGGATCACCACCC No data
Right 956198920 3:66684746-66684768 CACCACCCTATTGATTGGAGAGG No data
956198918_956198924 18 Left 956198918 3:66684731-66684753 CCACTCTCTTGGGATCACCACCC No data
Right 956198924 3:66684772-66684794 ATGTCCTTCCCTTAGAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956198918 Original CRISPR GGGTGGTGATCCCAAGAGAG TGG (reversed) Intergenic