ID: 956200680

View in Genome Browser
Species Human (GRCh38)
Location 3:66702406-66702428
Sequence GACCTCCTTGGTTTTCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956200676_956200680 8 Left 956200676 3:66702375-66702397 CCTCTGGACTGACCGTAAAAACT No data
Right 956200680 3:66702406-66702428 GACCTCCTTGGTTTTCAAACAGG No data
956200675_956200680 16 Left 956200675 3:66702367-66702389 CCATGGAGCCTCTGGACTGACCG No data
Right 956200680 3:66702406-66702428 GACCTCCTTGGTTTTCAAACAGG No data
956200673_956200680 30 Left 956200673 3:66702353-66702375 CCATTAGAGCTGCTCCATGGAGC No data
Right 956200680 3:66702406-66702428 GACCTCCTTGGTTTTCAAACAGG No data
956200677_956200680 -4 Left 956200677 3:66702387-66702409 CCGTAAAAACTCAGCCACAGACC No data
Right 956200680 3:66702406-66702428 GACCTCCTTGGTTTTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956200680 Original CRISPR GACCTCCTTGGTTTTCAAAC AGG Intergenic
No off target data available for this crispr