ID: 956202233

View in Genome Browser
Species Human (GRCh38)
Location 3:66718609-66718631
Sequence CTTGATGCCCAGACCACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956202232_956202233 -4 Left 956202232 3:66718590-66718612 CCAGCGAGATTTAGGAAATCTTG No data
Right 956202233 3:66718609-66718631 CTTGATGCCCAGACCACACCCGG No data
956202231_956202233 -3 Left 956202231 3:66718589-66718611 CCCAGCGAGATTTAGGAAATCTT No data
Right 956202233 3:66718609-66718631 CTTGATGCCCAGACCACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956202233 Original CRISPR CTTGATGCCCAGACCACACC CGG Intergenic
No off target data available for this crispr