ID: 956202233 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:66718609-66718631 |
Sequence | CTTGATGCCCAGACCACACC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
956202232_956202233 | -4 | Left | 956202232 | 3:66718590-66718612 | CCAGCGAGATTTAGGAAATCTTG | No data | ||
Right | 956202233 | 3:66718609-66718631 | CTTGATGCCCAGACCACACCCGG | No data | ||||
956202231_956202233 | -3 | Left | 956202231 | 3:66718589-66718611 | CCCAGCGAGATTTAGGAAATCTT | No data | ||
Right | 956202233 | 3:66718609-66718631 | CTTGATGCCCAGACCACACCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
956202233 | Original CRISPR | CTTGATGCCCAGACCACACC CGG | Intergenic | ||
No off target data available for this crispr |