ID: 956202630

View in Genome Browser
Species Human (GRCh38)
Location 3:66722314-66722336
Sequence AAGAAGAAGGAGAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956202630_956202636 25 Left 956202630 3:66722314-66722336 CCTCCCTCTTTCTCCTTCTTCTT No data
Right 956202636 3:66722362-66722384 GGAGTCTCGCTATTTTGCCCAGG No data
956202630_956202635 4 Left 956202630 3:66722314-66722336 CCTCCCTCTTTCTCCTTCTTCTT No data
Right 956202635 3:66722341-66722363 CTCTTCTTCTTTTTTAGAGTTGG No data
956202630_956202637 29 Left 956202630 3:66722314-66722336 CCTCCCTCTTTCTCCTTCTTCTT No data
Right 956202637 3:66722366-66722388 TCTCGCTATTTTGCCCAGGCTGG 0: 38
1: 2549
2: 42132
3: 151989
4: 245985

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956202630 Original CRISPR AAGAAGAAGGAGAAAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr