ID: 956202636

View in Genome Browser
Species Human (GRCh38)
Location 3:66722362-66722384
Sequence GGAGTCTCGCTATTTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956202629_956202636 29 Left 956202629 3:66722310-66722332 CCATCCTCCCTCTTTCTCCTTCT No data
Right 956202636 3:66722362-66722384 GGAGTCTCGCTATTTTGCCCAGG No data
956202631_956202636 22 Left 956202631 3:66722317-66722339 CCCTCTTTCTCCTTCTTCTTCTT 0: 2
1: 44
2: 246
3: 1388
4: 5970
Right 956202636 3:66722362-66722384 GGAGTCTCGCTATTTTGCCCAGG No data
956202634_956202636 -1 Left 956202634 3:66722340-66722362 CCTCTTCTTCTTTTTTAGAGTTG No data
Right 956202636 3:66722362-66722384 GGAGTCTCGCTATTTTGCCCAGG No data
956202633_956202636 12 Left 956202633 3:66722327-66722349 CCTTCTTCTTCTTCCTCTTCTTC 0: 34
1: 449
2: 1150
3: 3230
4: 9237
Right 956202636 3:66722362-66722384 GGAGTCTCGCTATTTTGCCCAGG No data
956202630_956202636 25 Left 956202630 3:66722314-66722336 CCTCCCTCTTTCTCCTTCTTCTT No data
Right 956202636 3:66722362-66722384 GGAGTCTCGCTATTTTGCCCAGG No data
956202632_956202636 21 Left 956202632 3:66722318-66722340 CCTCTTTCTCCTTCTTCTTCTTC 0: 6
1: 89
2: 814
3: 3135
4: 8661
Right 956202636 3:66722362-66722384 GGAGTCTCGCTATTTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956202636 Original CRISPR GGAGTCTCGCTATTTTGCCC AGG Intergenic
No off target data available for this crispr