ID: 956202637

View in Genome Browser
Species Human (GRCh38)
Location 3:66722366-66722388
Sequence TCTCGCTATTTTGCCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 442693
Summary {0: 38, 1: 2549, 2: 42132, 3: 151989, 4: 245985}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956202631_956202637 26 Left 956202631 3:66722317-66722339 CCCTCTTTCTCCTTCTTCTTCTT 0: 2
1: 44
2: 246
3: 1388
4: 5970
Right 956202637 3:66722366-66722388 TCTCGCTATTTTGCCCAGGCTGG 0: 38
1: 2549
2: 42132
3: 151989
4: 245985
956202634_956202637 3 Left 956202634 3:66722340-66722362 CCTCTTCTTCTTTTTTAGAGTTG No data
Right 956202637 3:66722366-66722388 TCTCGCTATTTTGCCCAGGCTGG 0: 38
1: 2549
2: 42132
3: 151989
4: 245985
956202632_956202637 25 Left 956202632 3:66722318-66722340 CCTCTTTCTCCTTCTTCTTCTTC 0: 6
1: 89
2: 814
3: 3135
4: 8661
Right 956202637 3:66722366-66722388 TCTCGCTATTTTGCCCAGGCTGG 0: 38
1: 2549
2: 42132
3: 151989
4: 245985
956202633_956202637 16 Left 956202633 3:66722327-66722349 CCTTCTTCTTCTTCCTCTTCTTC 0: 34
1: 449
2: 1150
3: 3230
4: 9237
Right 956202637 3:66722366-66722388 TCTCGCTATTTTGCCCAGGCTGG 0: 38
1: 2549
2: 42132
3: 151989
4: 245985
956202630_956202637 29 Left 956202630 3:66722314-66722336 CCTCCCTCTTTCTCCTTCTTCTT No data
Right 956202637 3:66722366-66722388 TCTCGCTATTTTGCCCAGGCTGG 0: 38
1: 2549
2: 42132
3: 151989
4: 245985

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956202637 Original CRISPR TCTCGCTATTTTGCCCAGGC TGG Intergenic
Too many off-targets to display for this crispr