ID: 956204519

View in Genome Browser
Species Human (GRCh38)
Location 3:66741592-66741614
Sequence ACTCATGCCACCCCATGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956204519_956204525 13 Left 956204519 3:66741592-66741614 CCTGGACATGGGGTGGCATGAGT No data
Right 956204525 3:66741628-66741650 TATGGTAAAAATCTGTGACAGGG No data
956204519_956204526 14 Left 956204519 3:66741592-66741614 CCTGGACATGGGGTGGCATGAGT No data
Right 956204526 3:66741629-66741651 ATGGTAAAAATCTGTGACAGGGG No data
956204519_956204524 12 Left 956204519 3:66741592-66741614 CCTGGACATGGGGTGGCATGAGT No data
Right 956204524 3:66741627-66741649 TTATGGTAAAAATCTGTGACAGG No data
956204519_956204522 -5 Left 956204519 3:66741592-66741614 CCTGGACATGGGGTGGCATGAGT No data
Right 956204522 3:66741610-66741632 TGAGTTGTTGTGGGCCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956204519 Original CRISPR ACTCATGCCACCCCATGTCC AGG (reversed) Intergenic
No off target data available for this crispr