ID: 956204526

View in Genome Browser
Species Human (GRCh38)
Location 3:66741629-66741651
Sequence ATGGTAAAAATCTGTGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956204519_956204526 14 Left 956204519 3:66741592-66741614 CCTGGACATGGGGTGGCATGAGT No data
Right 956204526 3:66741629-66741651 ATGGTAAAAATCTGTGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956204526 Original CRISPR ATGGTAAAAATCTGTGACAG GGG Intergenic
No off target data available for this crispr