ID: 956205483

View in Genome Browser
Species Human (GRCh38)
Location 3:66750537-66750559
Sequence GTTACATGGATGAGTTCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956205483_956205492 22 Left 956205483 3:66750537-66750559 CCTAAAGAACTCATCCATGTAAC No data
Right 956205492 3:66750582-66750604 AACAATTGAAATTAACAAAAGGG No data
956205483_956205491 21 Left 956205483 3:66750537-66750559 CCTAAAGAACTCATCCATGTAAC No data
Right 956205491 3:66750581-66750603 AAACAATTGAAATTAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956205483 Original CRISPR GTTACATGGATGAGTTCTTT AGG (reversed) Intergenic
No off target data available for this crispr