ID: 956205620

View in Genome Browser
Species Human (GRCh38)
Location 3:66751984-66752006
Sequence CCCTCATACAAAATAACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956205620_956205625 12 Left 956205620 3:66751984-66752006 CCATAGGTTATTTTGTATGAGGG No data
Right 956205625 3:66752019-66752041 GAGTCATCTCACCCTGCCCCTGG No data
956205620_956205627 20 Left 956205620 3:66751984-66752006 CCATAGGTTATTTTGTATGAGGG No data
Right 956205627 3:66752027-66752049 TCACCCTGCCCCTGGGCATTTGG No data
956205620_956205633 30 Left 956205620 3:66751984-66752006 CCATAGGTTATTTTGTATGAGGG No data
Right 956205633 3:66752037-66752059 CCTGGGCATTTGGCAATCTCTGG No data
956205620_956205626 13 Left 956205620 3:66751984-66752006 CCATAGGTTATTTTGTATGAGGG No data
Right 956205626 3:66752020-66752042 AGTCATCTCACCCTGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956205620 Original CRISPR CCCTCATACAAAATAACCTA TGG (reversed) Intergenic
No off target data available for this crispr