ID: 956206291

View in Genome Browser
Species Human (GRCh38)
Location 3:66758523-66758545
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956206291_956206296 -5 Left 956206291 3:66758523-66758545 CCTTCCAGCTCATTAATATCTAG No data
Right 956206296 3:66758541-66758563 TCTAGCTCCAGGTAACTCTGGGG No data
956206291_956206302 24 Left 956206291 3:66758523-66758545 CCTTCCAGCTCATTAATATCTAG No data
Right 956206302 3:66758570-66758592 ATGGCCAAGTGTTATGAGGTGGG No data
956206291_956206294 -7 Left 956206291 3:66758523-66758545 CCTTCCAGCTCATTAATATCTAG No data
Right 956206294 3:66758539-66758561 TATCTAGCTCCAGGTAACTCTGG No data
956206291_956206299 5 Left 956206291 3:66758523-66758545 CCTTCCAGCTCATTAATATCTAG No data
Right 956206299 3:66758551-66758573 GGTAACTCTGGGGGCATCAATGG No data
956206291_956206301 23 Left 956206291 3:66758523-66758545 CCTTCCAGCTCATTAATATCTAG No data
Right 956206301 3:66758569-66758591 AATGGCCAAGTGTTATGAGGTGG No data
956206291_956206300 20 Left 956206291 3:66758523-66758545 CCTTCCAGCTCATTAATATCTAG No data
Right 956206300 3:66758566-66758588 ATCAATGGCCAAGTGTTATGAGG No data
956206291_956206295 -6 Left 956206291 3:66758523-66758545 CCTTCCAGCTCATTAATATCTAG No data
Right 956206295 3:66758540-66758562 ATCTAGCTCCAGGTAACTCTGGG No data
956206291_956206297 -4 Left 956206291 3:66758523-66758545 CCTTCCAGCTCATTAATATCTAG No data
Right 956206297 3:66758542-66758564 CTAGCTCCAGGTAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956206291 Original CRISPR CTAGATATTAATGAGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr