ID: 956206292

View in Genome Browser
Species Human (GRCh38)
Location 3:66758527-66758549
Sequence GGAGCTAGATATTAATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956206292_956206296 -9 Left 956206292 3:66758527-66758549 CCAGCTCATTAATATCTAGCTCC No data
Right 956206296 3:66758541-66758563 TCTAGCTCCAGGTAACTCTGGGG No data
956206292_956206301 19 Left 956206292 3:66758527-66758549 CCAGCTCATTAATATCTAGCTCC No data
Right 956206301 3:66758569-66758591 AATGGCCAAGTGTTATGAGGTGG No data
956206292_956206300 16 Left 956206292 3:66758527-66758549 CCAGCTCATTAATATCTAGCTCC No data
Right 956206300 3:66758566-66758588 ATCAATGGCCAAGTGTTATGAGG No data
956206292_956206302 20 Left 956206292 3:66758527-66758549 CCAGCTCATTAATATCTAGCTCC No data
Right 956206302 3:66758570-66758592 ATGGCCAAGTGTTATGAGGTGGG No data
956206292_956206297 -8 Left 956206292 3:66758527-66758549 CCAGCTCATTAATATCTAGCTCC No data
Right 956206297 3:66758542-66758564 CTAGCTCCAGGTAACTCTGGGGG No data
956206292_956206299 1 Left 956206292 3:66758527-66758549 CCAGCTCATTAATATCTAGCTCC No data
Right 956206299 3:66758551-66758573 GGTAACTCTGGGGGCATCAATGG No data
956206292_956206304 30 Left 956206292 3:66758527-66758549 CCAGCTCATTAATATCTAGCTCC No data
Right 956206304 3:66758580-66758602 GTTATGAGGTGGGCTTCCTAAGG No data
956206292_956206295 -10 Left 956206292 3:66758527-66758549 CCAGCTCATTAATATCTAGCTCC No data
Right 956206295 3:66758540-66758562 ATCTAGCTCCAGGTAACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956206292 Original CRISPR GGAGCTAGATATTAATGAGC TGG (reversed) Intergenic
No off target data available for this crispr