ID: 956206298

View in Genome Browser
Species Human (GRCh38)
Location 3:66758548-66758570
Sequence TTGATGCCCCCAGAGTTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956206298_956206300 -5 Left 956206298 3:66758548-66758570 CCAGGTAACTCTGGGGGCATCAA No data
Right 956206300 3:66758566-66758588 ATCAATGGCCAAGTGTTATGAGG No data
956206298_956206304 9 Left 956206298 3:66758548-66758570 CCAGGTAACTCTGGGGGCATCAA No data
Right 956206304 3:66758580-66758602 GTTATGAGGTGGGCTTCCTAAGG No data
956206298_956206301 -2 Left 956206298 3:66758548-66758570 CCAGGTAACTCTGGGGGCATCAA No data
Right 956206301 3:66758569-66758591 AATGGCCAAGTGTTATGAGGTGG No data
956206298_956206302 -1 Left 956206298 3:66758548-66758570 CCAGGTAACTCTGGGGGCATCAA No data
Right 956206302 3:66758570-66758592 ATGGCCAAGTGTTATGAGGTGGG No data
956206298_956206305 13 Left 956206298 3:66758548-66758570 CCAGGTAACTCTGGGGGCATCAA No data
Right 956206305 3:66758584-66758606 TGAGGTGGGCTTCCTAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956206298 Original CRISPR TTGATGCCCCCAGAGTTACC TGG (reversed) Intergenic
No off target data available for this crispr