ID: 956206302

View in Genome Browser
Species Human (GRCh38)
Location 3:66758570-66758592
Sequence ATGGCCAAGTGTTATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956206292_956206302 20 Left 956206292 3:66758527-66758549 CCAGCTCATTAATATCTAGCTCC No data
Right 956206302 3:66758570-66758592 ATGGCCAAGTGTTATGAGGTGGG No data
956206291_956206302 24 Left 956206291 3:66758523-66758545 CCTTCCAGCTCATTAATATCTAG No data
Right 956206302 3:66758570-66758592 ATGGCCAAGTGTTATGAGGTGGG No data
956206298_956206302 -1 Left 956206298 3:66758548-66758570 CCAGGTAACTCTGGGGGCATCAA No data
Right 956206302 3:66758570-66758592 ATGGCCAAGTGTTATGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956206302 Original CRISPR ATGGCCAAGTGTTATGAGGT GGG Intergenic
No off target data available for this crispr