ID: 956212364

View in Genome Browser
Species Human (GRCh38)
Location 3:66814940-66814962
Sequence CAGGGAGAGAAAAGGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956212364_956212374 -7 Left 956212364 3:66814940-66814962 CCTTCAGCCCTTTTCTCTCCCTG No data
Right 956212374 3:66814956-66814978 CTCCCTGGAGATTGGGGGGTGGG No data
956212364_956212380 12 Left 956212364 3:66814940-66814962 CCTTCAGCCCTTTTCTCTCCCTG No data
Right 956212380 3:66814975-66814997 TGGGGCTGACCCTCTAAGGGTGG No data
956212364_956212373 -8 Left 956212364 3:66814940-66814962 CCTTCAGCCCTTTTCTCTCCCTG No data
Right 956212373 3:66814955-66814977 TCTCCCTGGAGATTGGGGGGTGG No data
956212364_956212378 8 Left 956212364 3:66814940-66814962 CCTTCAGCCCTTTTCTCTCCCTG No data
Right 956212378 3:66814971-66814993 GGGGTGGGGCTGACCCTCTAAGG No data
956212364_956212379 9 Left 956212364 3:66814940-66814962 CCTTCAGCCCTTTTCTCTCCCTG No data
Right 956212379 3:66814972-66814994 GGGTGGGGCTGACCCTCTAAGGG No data
956212364_956212375 -6 Left 956212364 3:66814940-66814962 CCTTCAGCCCTTTTCTCTCCCTG No data
Right 956212375 3:66814957-66814979 TCCCTGGAGATTGGGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956212364 Original CRISPR CAGGGAGAGAAAAGGGCTGA AGG (reversed) Intergenic
No off target data available for this crispr