ID: 956212597

View in Genome Browser
Species Human (GRCh38)
Location 3:66817003-66817025
Sequence TGTAATCTCAGTACTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412788
Summary {0: 7, 1: 223, 2: 4133, 3: 45828, 4: 362597}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956212597_956212601 10 Left 956212597 3:66817003-66817025 CCTCCTGAAGTACTGAGATTACA 0: 7
1: 223
2: 4133
3: 45828
4: 362597
Right 956212601 3:66817036-66817058 ACTGTTTGCCTTTTTACAGAAGG No data
956212597_956212603 21 Left 956212597 3:66817003-66817025 CCTCCTGAAGTACTGAGATTACA 0: 7
1: 223
2: 4133
3: 45828
4: 362597
Right 956212603 3:66817047-66817069 TTTTACAGAAGGAGACAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956212597 Original CRISPR TGTAATCTCAGTACTTCAGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr