ID: 956213903

View in Genome Browser
Species Human (GRCh38)
Location 3:66828462-66828484
Sequence CACCTTGTCCTGCTTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956213901_956213903 -4 Left 956213901 3:66828443-66828465 CCTAGAGCCACAATGCTGACACC No data
Right 956213903 3:66828462-66828484 CACCTTGTCCTGCTTGTGCCAGG No data
956213900_956213903 19 Left 956213900 3:66828420-66828442 CCTTAAAGAGGTCTAGATATCAG No data
Right 956213903 3:66828462-66828484 CACCTTGTCCTGCTTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956213903 Original CRISPR CACCTTGTCCTGCTTGTGCC AGG Intergenic
No off target data available for this crispr