ID: 956217387

View in Genome Browser
Species Human (GRCh38)
Location 3:66862679-66862701
Sequence GAGGGGTATATCAAGTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956217387_956217396 29 Left 956217387 3:66862679-66862701 CCTACCCACTTGATATACCCCTC No data
Right 956217396 3:66862731-66862753 AGACATTGCAAAATGTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956217387 Original CRISPR GAGGGGTATATCAAGTGGGT AGG (reversed) Intergenic
No off target data available for this crispr