ID: 956220899

View in Genome Browser
Species Human (GRCh38)
Location 3:66902057-66902079
Sequence CTTTATTAGCAGGGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956220890_956220899 22 Left 956220890 3:66902012-66902034 CCATTAAACTTCTTTCCTTTGTA No data
Right 956220899 3:66902057-66902079 CTTTATTAGCAGGGGGAAAATGG No data
956220893_956220899 -7 Left 956220893 3:66902041-66902063 CCTGTCTTGAGTATGCCTTTATT No data
Right 956220899 3:66902057-66902079 CTTTATTAGCAGGGGGAAAATGG No data
956220891_956220899 7 Left 956220891 3:66902027-66902049 CCTTTGTAAATCTCCCTGTCTTG No data
Right 956220899 3:66902057-66902079 CTTTATTAGCAGGGGGAAAATGG No data
956220892_956220899 -6 Left 956220892 3:66902040-66902062 CCCTGTCTTGAGTATGCCTTTAT No data
Right 956220899 3:66902057-66902079 CTTTATTAGCAGGGGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956220899 Original CRISPR CTTTATTAGCAGGGGGAAAA TGG Intergenic
No off target data available for this crispr