ID: 956221397

View in Genome Browser
Species Human (GRCh38)
Location 3:66907666-66907688
Sequence CTGTAATTGCTGAGGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956221397_956221400 -4 Left 956221397 3:66907666-66907688 CCTGGTTCCCTCAGCAATTACAG No data
Right 956221400 3:66907685-66907707 ACAGAACTTTTATAAAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956221397 Original CRISPR CTGTAATTGCTGAGGGAACC AGG (reversed) Intergenic
No off target data available for this crispr