ID: 956237041

View in Genome Browser
Species Human (GRCh38)
Location 3:67083868-67083890
Sequence GAGTTCCAATGTAATTGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956237031_956237041 30 Left 956237031 3:67083815-67083837 CCTGATTGGAGGCTGTTGGCATG No data
Right 956237041 3:67083868-67083890 GAGTTCCAATGTAATTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956237041 Original CRISPR GAGTTCCAATGTAATTGAGT TGG Intergenic
No off target data available for this crispr