ID: 956237061

View in Genome Browser
Species Human (GRCh38)
Location 3:67084078-67084100
Sequence CTGAAAATACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956237061_956237064 -7 Left 956237061 3:67084078-67084100 CCATTGTCCATTTGTATTTTCAG No data
Right 956237064 3:67084094-67084116 TTTTCAGTCCATCAAAATGGAGG No data
956237061_956237066 18 Left 956237061 3:67084078-67084100 CCATTGTCCATTTGTATTTTCAG No data
Right 956237066 3:67084119-67084141 TAAGTGTATTGAGTTGCGTGAGG No data
956237061_956237063 -10 Left 956237061 3:67084078-67084100 CCATTGTCCATTTGTATTTTCAG No data
Right 956237063 3:67084091-67084113 GTATTTTCAGTCCATCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956237061 Original CRISPR CTGAAAATACAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr