ID: 956246248

View in Genome Browser
Species Human (GRCh38)
Location 3:67186520-67186542
Sequence ACTAGGCAGTACCTCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956246239_956246248 25 Left 956246239 3:67186472-67186494 CCATTCTGGGTTCTAGAGGATGG No data
Right 956246248 3:67186520-67186542 ACTAGGCAGTACCTCAGTGTGGG No data
956246244_956246248 -5 Left 956246244 3:67186502-67186524 CCGTCTTCTCATAGCTCCACTAG 0: 165
1: 1953
2: 2073
3: 1213
4: 828
Right 956246248 3:67186520-67186542 ACTAGGCAGTACCTCAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956246248 Original CRISPR ACTAGGCAGTACCTCAGTGT GGG Intergenic
No off target data available for this crispr