ID: 956248184

View in Genome Browser
Species Human (GRCh38)
Location 3:67207596-67207618
Sequence TAATTTGTTGGAAGGACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956248181_956248184 6 Left 956248181 3:67207567-67207589 CCTGCATCGTATAGTCATTCTTT No data
Right 956248184 3:67207596-67207618 TAATTTGTTGGAAGGACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956248184 Original CRISPR TAATTTGTTGGAAGGACAGC TGG Intergenic
No off target data available for this crispr