ID: 956250110

View in Genome Browser
Species Human (GRCh38)
Location 3:67226762-67226784
Sequence ATCTTCCCAGTTAAGGTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956250106_956250110 6 Left 956250106 3:67226733-67226755 CCAAGCTGTCCACTCATTTCAAT No data
Right 956250110 3:67226762-67226784 ATCTTCCCAGTTAAGGTCTATGG No data
956250108_956250110 -3 Left 956250108 3:67226742-67226764 CCACTCATTTCAATGTGGCAATC No data
Right 956250110 3:67226762-67226784 ATCTTCCCAGTTAAGGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956250110 Original CRISPR ATCTTCCCAGTTAAGGTCTA TGG Intergenic
No off target data available for this crispr