ID: 956256625

View in Genome Browser
Species Human (GRCh38)
Location 3:67290202-67290224
Sequence CATCCCATGGAGAATATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956256625_956256629 8 Left 956256625 3:67290202-67290224 CCATCCATATTCTCCATGGGATG No data
Right 956256629 3:67290233-67290255 AGAAGGCCTTTTCCAGATACAGG No data
956256625_956256628 -9 Left 956256625 3:67290202-67290224 CCATCCATATTCTCCATGGGATG No data
Right 956256628 3:67290216-67290238 CATGGGATGATGCAGCAAGAAGG 0: 63
1: 197
2: 463
3: 850
4: 1838

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956256625 Original CRISPR CATCCCATGGAGAATATGGA TGG (reversed) Intergenic
No off target data available for this crispr