ID: 956256793

View in Genome Browser
Species Human (GRCh38)
Location 3:67291823-67291845
Sequence GGTTTTAGATTAGCGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956256793_956256799 12 Left 956256793 3:67291823-67291845 CCTGCAGCCGCTAATCTAAAACC No data
Right 956256799 3:67291858-67291880 AGCCTTGCATAAAGATAACCTGG No data
956256793_956256800 13 Left 956256793 3:67291823-67291845 CCTGCAGCCGCTAATCTAAAACC No data
Right 956256800 3:67291859-67291881 GCCTTGCATAAAGATAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956256793 Original CRISPR GGTTTTAGATTAGCGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr