ID: 956258018

View in Genome Browser
Species Human (GRCh38)
Location 3:67305045-67305067
Sequence ATGTTGTTAGTAAGGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956258018_956258021 -7 Left 956258018 3:67305045-67305067 CCCTTTGTCCTTACTAACAACAT 0: 1
1: 0
2: 1
3: 28
4: 249
Right 956258021 3:67305061-67305083 ACAACATCCTGATTTTGTGTAGG 0: 1
1: 0
2: 1
3: 25
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956258018 Original CRISPR ATGTTGTTAGTAAGGACAAA GGG (reversed) Intergenic
901887829 1:12236091-12236113 ATGTTTTTAGAAAGGAAATAAGG - Intronic
902161767 1:14536149-14536171 TTGTTATTAGTAATGACCAAGGG + Intergenic
904148812 1:28418997-28419019 ATGTTATTAGTAATTACCAATGG - Intronic
904991010 1:34592658-34592680 ATGTTGTAAGTAAACAGAAAAGG + Intergenic
906715068 1:47962525-47962547 ATATTATTATTAAGGGCAAAGGG - Intronic
908562811 1:65323926-65323948 AGATTGTTAGGAAGAACAAATGG + Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
910335834 1:86130258-86130280 ATGTTTTAGGTAAAGACAAAGGG + Intronic
911926804 1:103843003-103843025 ATGTAGATACTAAGGTCAAAGGG + Intergenic
912872399 1:113321086-113321108 TTGTTGTTAGTAGAGGCAAAGGG + Intergenic
915010741 1:152683920-152683942 ATGTTGTAAGTGAGGAAATAGGG - Intergenic
917393777 1:174569134-174569156 ATGTTGTTAGTATGGGGAAAAGG - Intronic
918621947 1:186615368-186615390 AGGCTGATAGTAAGGACGAATGG + Intergenic
918992058 1:191709482-191709504 CTACTGTTAGTAAGGAGAAAAGG - Intergenic
921242782 1:213203370-213203392 ATGTTGTCAGTAAGGATACGAGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921716469 1:218422121-218422143 ATATTGTTAGAAAAGATAAAAGG + Intronic
921915288 1:220602319-220602341 ATGTTGTTTGAAAGAACAAAAGG - Intronic
922532410 1:226354526-226354548 AGGATGTCAGCAAGGACAAAGGG - Intergenic
923791906 1:237118806-237118828 ATATTGTTAATAAGGAGAATAGG - Intronic
924787826 1:247216780-247216802 ATGTAGTTAGTAAAGGCACAAGG - Intergenic
924957472 1:248943719-248943741 ATGCTGATAAGAAGGACAAAGGG + Intergenic
1063287023 10:4700719-4700741 TTGCTGTTAGACAGGACAAATGG - Intergenic
1066122581 10:32304140-32304162 ATGTGGTCAGTAAAGTCAAAAGG - Intronic
1068301403 10:55146128-55146150 ATTATGTTAATAAGTACAAAAGG - Intronic
1068674975 10:59761476-59761498 AAGCTGTTTGGAAGGACAAAGGG - Intergenic
1070116092 10:73530189-73530211 GTATCTTTAGTAAGGACAAAAGG - Exonic
1070674618 10:78403969-78403991 AGGGTTGTAGTAAGGACAAAAGG - Intergenic
1072572494 10:96671135-96671157 ATGTCCTTAGAAAGCACAAAAGG + Intronic
1072866598 10:99068312-99068334 ATGTTGCTAATAAAGACATATGG + Intronic
1073415638 10:103379439-103379461 GTTCTGTTAGTAAGGAAAAAGGG + Intronic
1073530170 10:104223595-104223617 TTGCTCTTAGTAAGGACAATTGG + Intronic
1074886617 10:117699079-117699101 ATTTTGTTAGTAAGGAAGAGAGG + Intergenic
1076623068 10:131805209-131805231 TTGTTATTATTAAGGATAAAGGG + Intergenic
1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG + Exonic
1078344346 11:10531727-10531749 GAGTTGTTAGTAATGATAAAAGG - Intronic
1079775071 11:24514963-24514985 TTATTGTTAGTAAGACCAAAGGG + Intronic
1080068988 11:28056239-28056261 AAATTGTTATTAAGCACAAAGGG - Intronic
1081047815 11:38297722-38297744 ATGGTGTTTGTAAGGTTAAAAGG + Intergenic
1082822900 11:57556667-57556689 ATGGTCTCAGTAAGGAGAAAAGG + Intronic
1083034408 11:59623450-59623472 ATGCTGTTAGTATGGTCATAAGG - Intergenic
1083604030 11:63966716-63966738 ATGTTGTTTGTAAGGAATATTGG - Intergenic
1086272802 11:85087946-85087968 ATGTTTTAAGAAAGGAAAAAGGG + Intronic
1086846706 11:91758731-91758753 ATGTGATTAGGAATGACAAATGG - Intergenic
1089071768 11:115705917-115705939 ATCTTGTCACTAAGGAGAAAAGG + Intergenic
1089363667 11:117907991-117908013 ACGTTGTTGCTAAGGACCAAAGG - Intronic
1091510695 12:1121441-1121463 ATGTTGGTAGAGAGGAGAAAAGG + Intronic
1091893415 12:4081397-4081419 ATTCTGTTAGTAAGGAAGAAGGG + Intergenic
1093545635 12:20343024-20343046 ATGTTGTTAAAAGGGAAAAAAGG + Intergenic
1094877251 12:34663660-34663682 GTGTTTTTAGTATGTACAAAGGG + Intergenic
1095585972 12:43849702-43849724 AGGTTTTTAGTAAGAAAAAAAGG - Intronic
1097401697 12:59135105-59135127 ATGTTAATAGTCAAGACAAAAGG - Intergenic
1098714325 12:73810541-73810563 TTTTTGTTAGGAAGGGCAAATGG + Intergenic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1099123754 12:78726334-78726356 ACGTTGTTAGGCAGGGCAAAGGG - Intergenic
1099372354 12:81851406-81851428 ATATTGTAAGTATGGAAAAAAGG - Intergenic
1099401130 12:82204852-82204874 ACTTTGTTTGTAAGGAGAAATGG - Intergenic
1100460506 12:94794770-94794792 ATGCTGTTAATAATGACACAAGG + Intergenic
1100483804 12:95005297-95005319 TTGTTGTTAGTAATGTAAAATGG - Intergenic
1100935614 12:99661703-99661725 AAGGTGTTACTAAAGACAAAAGG - Intronic
1101452554 12:104793188-104793210 ATGGTGTTGGTAAGGTCAGATGG + Intergenic
1101475819 12:105047245-105047267 ATTCTGTTACTAAGGACAGAGGG - Intronic
1105043584 12:132982804-132982826 ATGATGTTAGCATGGTCAAAGGG - Intergenic
1105899819 13:24744864-24744886 ATGTTGTTAATGGGGACCAAGGG + Intergenic
1106440540 13:29763202-29763224 ATGTGGTAAGGAAGGACATAAGG + Intergenic
1106887409 13:34203521-34203543 ATGATGCTAGAAATGACAAAAGG + Intergenic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1107305480 13:39013934-39013956 ATGTTGGTGGTAAGGGCAAAGGG + Exonic
1107719496 13:43232962-43232984 ATATTGTTATAAAGGAAAAATGG - Intronic
1108946923 13:56038303-56038325 ATGTTGGTAGTAAGGAAAAGAGG + Intergenic
1109820963 13:67653659-67653681 AAGTTATTAAAAAGGACAAAAGG - Intergenic
1111840399 13:93442363-93442385 ATGCTGGTAGAAAGGAGAAAAGG + Intronic
1113139882 13:107135442-107135464 GTGATGTTATTAAGGACAGAAGG - Intergenic
1114053526 14:18944263-18944285 ATGTTTTGACTTAGGACAAATGG + Intergenic
1114109030 14:19457662-19457684 ATGTTTTGACTTAGGACAAATGG - Intergenic
1114162315 14:20182127-20182149 TTGCTGTTAGTAAGGAGAATTGG + Intergenic
1114621886 14:24101090-24101112 ATGGTGTTAGTAAAAATAAAGGG - Intronic
1115797426 14:36954365-36954387 CTGTAGTTAGTAAGGAGAAATGG - Intronic
1115972659 14:38963176-38963198 ATGTTGTGGGAAAGGAAAAAGGG - Intergenic
1116160296 14:41259142-41259164 ATTTTGTTTCTAAAGACAAATGG - Intergenic
1117158135 14:52961084-52961106 ATTGTGTTACAAAGGACAAAGGG - Intergenic
1118059812 14:62123252-62123274 ATGTGGTTAGCAGGGACAGATGG + Intergenic
1119663911 14:76470616-76470638 ACGTTGTTGGTATGGAAAAAGGG + Intronic
1122238961 14:100349257-100349279 ATGGTGATAATAGGGACAAAGGG - Intronic
1123908434 15:24943192-24943214 ATTTTGTTTGGAAGGACATATGG - Intronic
1125110841 15:36031663-36031685 AGGTTGTTATTAAGAACTAAAGG + Intergenic
1127069795 15:55277771-55277793 TAGTTGATAGTAAGGCCAAACGG - Intronic
1128598097 15:68972260-68972282 ATGTTGTGAGGAAGGAGAGATGG - Intronic
1128993584 15:72280397-72280419 ATGGTGTTTGAAAGGAGAAATGG - Intronic
1129902866 15:79165124-79165146 ATGATGGTAGAAAGGGCAAATGG + Intergenic
1129952618 15:79605505-79605527 ATGTTGTTTGGAAGGGGAAATGG - Intergenic
1130950084 15:88579320-88579342 ATTTTGTTAATAAGGGGAAAAGG + Intergenic
1132832875 16:1937901-1937923 ATGTTGTTAATAAAGACAGCAGG + Intergenic
1138732836 16:59214989-59215011 ATGTTATAAGTGAGGACAAAAGG - Intergenic
1139096633 16:63712240-63712262 AGATTGTTAGTAAGGAAAATGGG - Intergenic
1139167299 16:64582284-64582306 ATGTTGTTTGTTAGGCTAAAGGG - Intergenic
1139223239 16:65206613-65206635 ATTTTGTTACTATGCACAAAAGG + Intergenic
1141012253 16:80413691-80413713 ATATCGTTAGTAAGAAAAAAAGG + Intergenic
1141258144 16:82422981-82423003 ATGCTGTGAGGAAGGAGAAATGG + Intergenic
1145290779 17:21544090-21544112 ATGTTGCTTGTTAGGAAAAAAGG - Intronic
1148530232 17:48383163-48383185 ATGTTGGTAATAAAGAGAAATGG - Intronic
1150059356 17:62051104-62051126 TTTTTGTTAGTAAGAAGAAAGGG - Intronic
1152395913 17:80033184-80033206 ATGTGGTAAGTAATGTCAAATGG - Intronic
1153499896 18:5737817-5737839 ATGTTGACATTAAGGAGAAATGG - Intergenic
1153786392 18:8538813-8538835 GTTTTGTTATTAAGGAGAAAGGG - Intergenic
1155223088 18:23703009-23703031 TTGATGGTAGTAATGACAAAAGG - Intronic
1155695672 18:28682808-28682830 AAGTTGTAAGGAAAGACAAAAGG - Intergenic
1156153827 18:34277428-34277450 ATGATGTTAATAAGGCAAAAAGG - Intergenic
1156959889 18:43013780-43013802 ATGTTGTGTGTAAAGACAAAAGG + Intronic
1157687448 18:49653805-49653827 GTTTTGTTAGTAAGGACGAAGGG + Intergenic
1159406865 18:68014539-68014561 ATGTTGTTAATAAAGACAGCAGG - Intergenic
1159584706 18:70272658-70272680 ATGTTGATAAGAAGGGCAAAAGG - Intergenic
1159970050 18:74638881-74638903 ATGTTATTAGTTAGGAAACAAGG + Intronic
1160214026 18:76910807-76910829 ATGTAGTGAGTATGGACAGAGGG + Exonic
1160653686 19:248015-248037 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1166345699 19:42163958-42163980 CTGTTGTTAGGAAGAAGAAAAGG + Intronic
1167139512 19:47639942-47639964 ATGTTGTTAGAAAGAACAGCAGG - Intronic
1168495355 19:56843311-56843333 ATGTTGGTGGTAAGGAAAAAAGG - Intergenic
925501793 2:4513072-4513094 ATGTGGGTAGTGAGGAAAAACGG + Intergenic
926122306 2:10250522-10250544 ATGTTTTTATTAATGACAACAGG + Intergenic
927014678 2:18946339-18946361 ATGTTTTTAGTGAGAACACATGG - Intergenic
929886534 2:45883738-45883760 ATGCTGGAAGGAAGGACAAATGG + Intronic
930189927 2:48447141-48447163 TTGTTGTTAGTAAGTGCCAAAGG + Intronic
931060149 2:58519219-58519241 ATTTTGTTAATTAGGAAAAAAGG - Intergenic
931355185 2:61531343-61531365 TTTTTGTTTGTAAGGACAATAGG - Intronic
933405249 2:81850119-81850141 ATGTTGTGAGTAAAAACTAATGG + Intergenic
933544128 2:83688397-83688419 ATGTTCTTCCTAATGACAAATGG - Intergenic
935869773 2:107434102-107434124 ATGTTCATAGTTATGACAAAGGG - Intergenic
936266109 2:111008549-111008571 ACGTTGTTTGTAATGACCAAAGG - Intronic
936570051 2:113605011-113605033 ATGCTGATAAGAAGGACAAAGGG - Intergenic
936664802 2:114581882-114581904 ATGTTGTTAACAAGGAAAACTGG - Intronic
937652140 2:124331121-124331143 GTGTTGTCATTAAGGACATATGG - Intronic
939261674 2:139818682-139818704 TTTTTATTAGTAAGGACAAATGG - Intergenic
939486752 2:142823166-142823188 ATGTTGTTAAGAATGAGAAAGGG + Intergenic
939520937 2:143229804-143229826 AAGATTTTAGTAAGAACAAAAGG + Intronic
941173387 2:162167067-162167089 ATGTTTTAAGTAAGTAAAAATGG + Intergenic
941615249 2:167711396-167711418 ATGTTTTTAGAATGAACAAATGG + Intergenic
942233981 2:173886509-173886531 AGGTATTTAGTAATGACAAAGGG + Intergenic
943169846 2:184384803-184384825 ATGTTGTAATTCAGGGCAAAAGG - Intergenic
944352739 2:198748006-198748028 ATGTTCTTAGTAAGGAAAACTGG + Intergenic
945281634 2:208040923-208040945 ATGTTGCTAGGGAGGAAAAAAGG - Intergenic
947499862 2:230664147-230664169 ATGCTGTTAGTAAGGAAGAAGGG + Intergenic
947648338 2:231762045-231762067 ACATTGTTAGGAAGGGCAAAAGG - Intronic
1169009699 20:2239887-2239909 ATGTGTATGGTAAGGACAAAAGG - Intergenic
1169611019 20:7380216-7380238 ACGTTGTTTGGAAGGAGAAATGG - Intergenic
1170519704 20:17171672-17171694 ATGTCGTTAGCCAGGACAATGGG - Intergenic
1172939143 20:38642768-38642790 ATATAGCCAGTAAGGACAAAGGG - Intronic
1173092741 20:39989497-39989519 ATGCTGCTTGTAAGGAGAAATGG - Intergenic
1175701513 20:61141131-61141153 ATGTTGGTAATAGTGACAAAAGG - Intergenic
1176276696 20:64276098-64276120 ATGATGTTAATAAAGAAAAAAGG - Exonic
1176277952 20:64285000-64285022 ATGCTGATAAGAAGGACAAAGGG + Intronic
1177567164 21:22839293-22839315 TTGTTGGTAGTAATGAAAAATGG - Intergenic
1179728044 21:43351136-43351158 ATTTTGATAGTGAGGAAAAAAGG - Intergenic
1179789178 21:43746254-43746276 ACCTTGTTAGGAAGGAGAAAGGG + Intronic
1180263933 21:46697610-46697632 ATGCTGATAAGAAGGACAAAGGG + Intergenic
1180471996 22:15666644-15666666 ATGTTTTGACTTAGGACAAATGG + Intergenic
1185430165 22:50805967-50805989 ATGCTGATAAGAAGGACAAAGGG + Intergenic
950473606 3:13201914-13201936 ATCCTGCTAGTTAGGACAAATGG + Intergenic
951109031 3:18779329-18779351 ATTTTGTGAGTAAAGATAAAGGG - Intergenic
955240735 3:57175820-57175842 ATGTTAATAGTAAGGAAAACTGG - Intergenic
955886781 3:63607963-63607985 AGGTTATTATTAAGAACAAAAGG + Intronic
956258018 3:67305045-67305067 ATGTTGTTAGTAAGGACAAAGGG - Intergenic
957364597 3:79206154-79206176 ATGTGGTTACTCTGGACAAAGGG - Intronic
959853694 3:111121993-111122015 ATGTTGAGACTAAGGAAAAATGG + Intronic
961789856 3:129367831-129367853 ATCCTGCTAGTTAGGACAAATGG - Intergenic
962046172 3:131761477-131761499 ATGTTGTCTGGAATGACAAATGG + Intronic
963620994 3:147606342-147606364 ATGTTTTCAGTATGGACAAATGG - Intergenic
965116574 3:164497267-164497289 ATGTTATTATTAAAGATAAAAGG - Intergenic
965884253 3:173424304-173424326 ATGTTATTAGCAAAGACAATGGG - Intronic
967538024 3:190629544-190629566 TTGTGGTGAATAAGGACAAAAGG + Intronic
967816886 3:193806962-193806984 ATGATGTTACAAAGGCCAAAGGG + Intergenic
968373117 4:12997-13019 ATGCTGATAAGAAGGACAAAGGG - Intergenic
970773400 4:19642552-19642574 ATGTTGTTGGTAAGGATGGAGGG - Intergenic
973626428 4:52777211-52777233 ATTTTATTAGTAAGGAAGAAAGG - Intergenic
974969423 4:68805694-68805716 ATGTTGTTGGTATAAACAAATGG - Intergenic
974978273 4:68919272-68919294 CTGTTGGTGGTAATGACAAATGG + Intergenic
976360679 4:84174517-84174539 GTGTTGTTGCTAAGGTCAAATGG + Intergenic
978228501 4:106367885-106367907 ATGTTGTTAGAAAGCAAGAAGGG - Intergenic
978541885 4:109825729-109825751 AAGATGTTAGTAAGCACCAAAGG + Intergenic
978986162 4:115015428-115015450 ATTTTGTTTGGAAGGAGAAATGG + Intronic
979025669 4:115571264-115571286 ATGTAGAGAGTAAGGAAAAATGG + Intergenic
979397060 4:120201644-120201666 ATTTTATTAGTAAGAAAAAAGGG - Intergenic
979434113 4:120668960-120668982 ATTTAGTTAGTAAAGAGAAAGGG - Intergenic
981751903 4:148100613-148100635 CTGTTGTTAGCAATGAAAAATGG + Intronic
982653040 4:158111260-158111282 ATGTTGTGAGTTTGAACAAAGGG - Intergenic
983022015 4:162689083-162689105 ATCTTTTAAGTAAGGACAAGTGG + Intergenic
983833886 4:172365755-172365777 AACTTTTAAGTAAGGACAAAAGG + Intronic
984896191 4:184542372-184542394 ATGTTAACAGTAAGTACAAATGG - Intergenic
985168736 4:187125844-187125866 ATGCTGTGAAGAAGGACAAATGG - Intergenic
985462275 4:190119567-190119589 ATGCTGATAAGAAGGACAAAGGG + Intergenic
987475697 5:18389866-18389888 ATTTTGATAGTAAGGAAAAAAGG - Intergenic
987735627 5:21839245-21839267 ATTTTGTTATTAAGGAAAACAGG - Intronic
988211478 5:28210178-28210200 CTGTTGTTATGAAGGACAACGGG - Intergenic
988414326 5:30927035-30927057 ATGTTTTTAATAAATACAAAAGG + Intergenic
989378781 5:40793732-40793754 ATGTTGTTAGGAGAGAGAAAGGG - Intronic
990205203 5:53421426-53421448 ATGTTGTTGTTAAAGACAACAGG - Intergenic
990719985 5:58683749-58683771 GTGTGGATAGTATGGACAAAGGG - Intronic
992594059 5:78327749-78327771 ATGTTGTAAGTAAGGTCTACTGG - Intergenic
992975700 5:82117097-82117119 ATGTTCTTATTGAGGATAAAAGG + Intronic
994192967 5:96889036-96889058 ATGTTGTCAATAAGGATAAGAGG - Intronic
994455656 5:100003926-100003948 TTGTTGTTAGTAAGTAAAAGGGG - Intergenic
998309148 5:141109430-141109452 GTGCTGTTATTAAGGACAAGTGG + Intronic
998535756 5:142929434-142929456 TAGTTGTTAGTAGGGACATAAGG + Intronic
998799800 5:145857297-145857319 GTGGTGTTAAAAAGGACAAAAGG - Intergenic
998944520 5:147323460-147323482 ATGTTGTTAGTATAGAAAAATGG + Intronic
1001890050 5:175331238-175331260 ATGTGGTTAGTAAGGCCATATGG - Intergenic
1001890106 5:175331684-175331706 ATGTGGTTAGTAAGGGCATGTGG - Intergenic
1001890122 5:175331758-175331780 ATGTGGTTAGTAAGGGCATGTGG - Intergenic
1001890130 5:175331795-175331817 ATGTGGTTAGTAAGGGCATGTGG - Intergenic
1001890139 5:175331832-175331854 ATGTGGTTAGGAAGGCCAAGTGG - Intergenic
1001890159 5:175331944-175331966 ATGTGGTTAGTAAGGCCAAGTGG - Intergenic
1001890175 5:175332035-175332057 ATGTGGTTAGTAAGGGCATGTGG - Intergenic
1001890192 5:175332127-175332149 ATGTGGTTAGTAAGGCCAAGTGG - Intergenic
1001890198 5:175332164-175332186 ATGTGGTTAGTAAGGGCATGTGG - Intergenic
1002430769 5:179202716-179202738 ATGGTGTGAGTAAGGAAACACGG - Intronic
1002754945 6:149542-149564 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1010184776 6:73130989-73131011 ATGTAGTTGAGAAGGACAAAAGG + Intronic
1010260892 6:73815701-73815723 ATCTTGTTAATAAGGAAAAAGGG + Intronic
1010437515 6:75851108-75851130 ATGTTGTTAGAAGTGATAAATGG + Intronic
1010496570 6:76539686-76539708 ATGCTGTTAGGAAGGAGAATGGG + Intergenic
1010550443 6:77215817-77215839 ATGTTCTTATTAAGAAAAAATGG + Intergenic
1011912668 6:92462377-92462399 AAGTTGATAGTAAGAACACAAGG + Intergenic
1013565394 6:111354629-111354651 ATGTTTTTAGAGAGGAAAAATGG - Intronic
1013788115 6:113805989-113806011 CTGTTGTTAATACGGACAAATGG - Intergenic
1014120435 6:117719348-117719370 ATGTTGTTACTATGGGAAAATGG + Intergenic
1015527610 6:134188374-134188396 ATTTTGCTTGTAAGGAGAAATGG - Intronic
1016081231 6:139860052-139860074 ATTTTTTTACTAAGGAGAAAGGG - Intergenic
1018286355 6:162242850-162242872 ATCTTCATGGTAAGGACAAAGGG + Intronic
1018769486 6:166958219-166958241 GTATTTTTAGTAGGGACAAAAGG - Intergenic
1019951159 7:4373868-4373890 CTGGTGTTTGTAAGGACAACAGG + Intergenic
1020102202 7:5400297-5400319 TTGTTTTAAGCAAGGACAAATGG - Intronic
1020159418 7:5757444-5757466 ATTTTGTTAGGAAGGAAAAAAGG - Intronic
1020733644 7:11917523-11917545 ATATTGTTGTAAAGGACAAAGGG - Intergenic
1021972179 7:25976277-25976299 ATGACGTTAGTAAAGAAAAATGG + Intergenic
1022742971 7:33140775-33140797 ATGTCATTAGTAATAACAAATGG + Intronic
1023070243 7:36423373-36423395 ACGTGGTTATTAATGACAAATGG + Intronic
1023358612 7:39393299-39393321 ATGTCGTTAGGAAAAACAAATGG - Intronic
1023551147 7:41371031-41371053 ATGTTGTTGGAAAGGAAAAAAGG + Intergenic
1024431429 7:49292476-49292498 AAGGTGGTTGTAAGGACAAATGG - Intergenic
1026394477 7:69937424-69937446 AGGTTGTTTGTAAGGAGACATGG + Intronic
1027359773 7:77395754-77395776 ATGTGGAAAGTAAGTACAAAGGG + Intronic
1028573488 7:92318628-92318650 ATGTTGTTATTAAGGACTGTAGG - Intronic
1030356932 7:108553591-108553613 ATGTTTTTGGTATGGGCAAAAGG - Intronic
1030857847 7:114583523-114583545 ATGTTGATAGTAAGGCCTAGGGG - Intronic
1032378419 7:131448679-131448701 ATGTTATTAGAAAAGACAAATGG + Intronic
1033480942 7:141739718-141739740 ATGTGGTAAGTGAGGAAAAATGG - Intronic
1033683337 7:143617974-143617996 ATTTGGTTAGAAAGGACAATAGG + Intergenic
1033701276 7:143839664-143839686 ATTTGGTTAGAAAGGACAATAGG - Intergenic
1033938925 7:146626824-146626846 ATGTTGTTATTCAGGTTAAATGG - Intronic
1034370906 7:150595489-150595511 GTTTTGTTAGTAAGGAGGAAAGG - Intergenic
1035513216 8:207810-207832 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1038921553 8:32090717-32090739 ATGTTGTTGGTAGTGATAAAAGG - Intronic
1039007141 8:33051697-33051719 ATGTTTTGAGGAATGACAAAGGG + Intergenic
1042477698 8:69267492-69267514 ATGTTGTTTCTAATGACACAGGG + Intergenic
1043064314 8:75547601-75547623 GTGTTGTTGACAAGGACAAAAGG + Exonic
1043588412 8:81796545-81796567 ATTTTGTTAGCAAAGACAACAGG - Intergenic
1044071342 8:87763889-87763911 ATGTTGTTAGTATGAAAGAAGGG - Intergenic
1044219039 8:89648272-89648294 AAGGTTTTAGTAAAGACAAAGGG - Intergenic
1045205570 8:100036281-100036303 ATGGTGTTGGCAAGGAGAAAGGG - Intronic
1046946031 8:119975150-119975172 ATTTTTTTAAAAAGGACAAAAGG + Intronic
1055161334 9:73131988-73132010 ATGGTGTTAGTAAAAAAAAAAGG + Intergenic
1057087091 9:92221165-92221187 ATGTAGTATATAAGGACAAAAGG + Intronic
1059536189 9:115083279-115083301 ATGTTATTATTAAGGAAAAAAGG + Intronic
1060022186 9:120141212-120141234 ATTTTGTAAATAAGGACACAAGG - Intergenic
1060870551 9:127036463-127036485 CTGTTGTTATGAAGAACAAATGG + Intronic
1186233376 X:7480195-7480217 ATGTTTATTCTAAGGACAAAGGG + Intergenic
1186358114 X:8808634-8808656 ATGTTATTATAAAGGACAACAGG + Intergenic
1187269081 X:17763448-17763470 ATATTGTTAGCAATGACAAAGGG + Intergenic
1187320446 X:18233208-18233230 ATATTGTTAGCAATGACAAAGGG - Intergenic
1189772150 X:44437527-44437549 GTTTTGTAAGTAAGGAGAAAGGG + Intergenic
1189818137 X:44844771-44844793 ATTTTGTTAGTAAAGAAAACCGG + Exonic
1195842246 X:109186970-109186992 CTGTTTTTGGTAAGGATAAAAGG + Intergenic
1197309916 X:124892046-124892068 ATGTTGTTAGTAAGGTGAAATGG + Intronic
1197844190 X:130783654-130783676 TTGTTGTTAGCAGGGTCAAAGGG + Exonic
1197948892 X:131873103-131873125 ACATTGTTTGGAAGGACAAATGG - Intergenic
1199351467 X:146806512-146806534 TTGTTGGTAGTAATGTCAAATGG + Intergenic
1199352440 X:146817981-146818003 TTGTTGGTAGTAATGTCAAATGG - Intergenic
1200828931 Y:7671868-7671890 ATGTTGGTAGAAAAGACCAAAGG - Intergenic
1201722337 Y:17113274-17113296 ATTTTGTTAGGAAGGAGAAAGGG + Intergenic