ID: 956258211

View in Genome Browser
Species Human (GRCh38)
Location 3:67307372-67307394
Sequence CACATCTATCAGTATGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956258208_956258211 -8 Left 956258208 3:67307357-67307379 CCCTTTTGTCTGCAGCACATCTA No data
Right 956258211 3:67307372-67307394 CACATCTATCAGTATGAACTGGG No data
956258209_956258211 -9 Left 956258209 3:67307358-67307380 CCTTTTGTCTGCAGCACATCTAT No data
Right 956258211 3:67307372-67307394 CACATCTATCAGTATGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956258211 Original CRISPR CACATCTATCAGTATGAACT GGG Intergenic
No off target data available for this crispr