ID: 956262745

View in Genome Browser
Species Human (GRCh38)
Location 3:67362937-67362959
Sequence AAGCCTAGGCCCCATCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956262745_956262748 4 Left 956262745 3:67362937-67362959 CCCGTGAGATGGGGCCTAGGCTT 0: 1
1: 0
2: 0
3: 12
4: 125
Right 956262748 3:67362964-67362986 TCTAAAACCACATCTTTGCCAGG 0: 1
1: 0
2: 0
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956262745 Original CRISPR AAGCCTAGGCCCCATCTCAC GGG (reversed) Intronic