ID: 956263689

View in Genome Browser
Species Human (GRCh38)
Location 3:67374004-67374026
Sequence CAGTCAACCCAATTTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956263689 Original CRISPR CAGTCAACCCAATTTGGAGG AGG (reversed) Intronic
901150285 1:7096787-7096809 CAGGCAAACCAATGGGGAGGAGG - Intronic
910325853 1:86006198-86006220 CAGCCAACCCAACTTGAAAGAGG + Intronic
913983339 1:143543393-143543415 CTGTCAACCCAACTTGGGGCAGG - Intergenic
924151919 1:241138310-241138332 CAGTCAACCAAAATTGTGGGGGG + Intronic
1065869393 10:29943451-29943473 GAGTCAGCCAAAGTTGGAGGGGG + Intergenic
1067337594 10:45377700-45377722 CAGACTACCCATCTTGGAGGGGG - Intronic
1070480298 10:76875624-76875646 CACTCTAACAAATTTGGAGGTGG + Intronic
1070667547 10:78356157-78356179 CATTCAACCCACTATGGAGTGGG + Intergenic
1072215964 10:93287366-93287388 CAGCCAACCCAAGGTAGAGGTGG - Intergenic
1072752466 10:97992225-97992247 CAGCCCACCTTATTTGGAGGGGG + Intronic
1079114517 11:17632723-17632745 CAGTCAAACCTAATTGGGGGAGG - Intronic
1079598322 11:22281377-22281399 CAGTCACCCCAGTTTGGACTGGG + Exonic
1088733976 11:112709940-112709962 CAGTCAGCCCAGTGTGGTGGTGG - Intergenic
1091900321 12:4139427-4139449 CAGGAAACCCAAGTAGGAGGAGG - Intergenic
1095567184 12:43638878-43638900 CATTTAAATCAATTTGGAGGAGG + Intergenic
1099402726 12:82219746-82219768 CAGACATAGCAATTTGGAGGAGG + Intergenic
1101858916 12:108466785-108466807 CAGTCAACCCTCTATGGTGGTGG - Intergenic
1102595067 12:113986040-113986062 AATTCAACCCAAATGGGAGGGGG + Intergenic
1102652962 12:114456028-114456050 CAGTATACCCATTTTGCAGGAGG + Intergenic
1105574533 13:21637685-21637707 CAGCAAACCAAATTTGGATGTGG + Intergenic
1106784889 13:33096885-33096907 CAGTCTACTCAATGTGGAGGTGG - Intergenic
1109830193 13:67776065-67776087 AAATAAACCCAATTTGGACGTGG + Intergenic
1110355198 13:74559476-74559498 CATTCAACCCACTATAGAGGTGG - Intergenic
1111406475 13:87813323-87813345 CAGTCTCTCCAATTTGGGGGGGG - Intergenic
1111720973 13:91944706-91944728 CAGTCAACCTAGTTTGGAGTAGG - Intronic
1117126212 14:52628948-52628970 AAGACAACCCAATTTGGAAGTGG + Intronic
1118158189 14:63262165-63262187 CAGCCAACCCAATGAGGAAGGGG + Intronic
1120781020 14:88485803-88485825 CAGTGAACCCAATCAGGAGGAGG - Exonic
1123691524 15:22842296-22842318 GTGTCAACCAAATATGGAGGAGG + Intronic
1128558836 15:68651184-68651206 AAGTCATCCCGCTTTGGAGGCGG - Intronic
1132925414 16:2426812-2426834 CAGTCTACCCATGTGGGAGGTGG - Intergenic
1137973726 16:53012264-53012286 CAGTCAACAAAGTCTGGAGGAGG - Intergenic
1138864254 16:60797010-60797032 CAGCCAAACCAAGTTGGAGTAGG - Intergenic
1140414447 16:74763905-74763927 CAGGCAAGCAAATTTGAAGGTGG - Intronic
1143767419 17:9146729-9146751 CTCTCAAAACAATTTGGAGGAGG + Intronic
1144751532 17:17652143-17652165 CAGTCAAACCAGATTGGAGCTGG + Intergenic
1145273707 17:21417945-21417967 CAGTCATCCCAGTTGGCAGGAGG - Exonic
1146626644 17:34440121-34440143 CAGTGAAGCCTATTAGGAGGGGG - Intergenic
1149738957 17:59024859-59024881 CAGTCAAAATACTTTGGAGGAGG + Intronic
1150530232 17:65973418-65973440 CAGTCAACCCAATTTAAAAATGG + Intronic
1151053353 17:71004502-71004524 GAGTCAAACCTTTTTGGAGGAGG - Intergenic
926014581 2:9438377-9438399 CTGGCAACCCAATTTGATGGTGG - Intronic
927232051 2:20833882-20833904 CATTAAAACCGATTTGGAGGCGG + Intergenic
928920115 2:36518012-36518034 TAATCATCCCAACTTGGAGGGGG - Intronic
934105317 2:88690239-88690261 CAGGAAACCCAATTTAGATGAGG + Intergenic
942164556 2:173229555-173229577 CATTCAACCCAACCTGCAGGAGG + Intronic
1175924189 20:62463933-62463955 CATCCAACCCAGTGTGGAGGGGG + Exonic
1178534761 21:33402881-33402903 CAGTCAACCCCATTTTGAAAAGG - Exonic
949226222 3:1699403-1699425 CTGTCCAGCCAATTTGGAAGGGG - Intergenic
949442287 3:4094908-4094930 CAGTGAACCCTACTTTGAGGAGG + Intronic
956263689 3:67374004-67374026 CAGTCAACCCAATTTGGAGGAGG - Intronic
959361290 3:105395998-105396020 CAGTCAACTAACATTGGAGGAGG + Intronic
959536956 3:107497476-107497498 CAGTCAATCTATTTTGGAGGTGG + Intergenic
965869514 3:173249382-173249404 GAGTCAAACCAATTGGGAGCAGG + Intergenic
968773989 4:2528086-2528108 CAGACAACCCAATTTGAAAATGG + Intronic
980785275 4:137545574-137545596 CAGTCATAACAGTTTGGAGGAGG - Intergenic
981132845 4:141177258-141177280 CAGTGAACCCAATATAGAGATGG + Intronic
986771242 5:10975876-10975898 CAGTCAAAGCAATTTGAACGAGG - Intronic
988198542 5:28040712-28040734 AAGTCAAACCAATGTGGAGTTGG - Intergenic
989385661 5:40852623-40852645 CAGTCAACACAGTTTTCAGGGGG + Exonic
990494872 5:56337372-56337394 CAGTCACCCCAAGTAGGAGCTGG + Intergenic
991508271 5:67348831-67348853 CAGTCAACTCATTTTGGACAAGG + Intergenic
991725771 5:69534382-69534404 CAGTCTTCCTAATATGGAGGTGG + Intronic
991869183 5:71093482-71093504 CAGTCTTCCTAATATGGAGGTGG - Intergenic
995987398 5:118195143-118195165 CATTGAACCTAATTTGGATGAGG - Intergenic
1001147679 5:169199061-169199083 CAGTAAGCCCAGTTTGGAGGAGG + Intronic
1003469411 6:6415409-6415431 TAGTCAAATCAATTTGGAGTTGG + Intergenic
1015666997 6:135642699-135642721 CAGCCTACCCAATTTGAAGATGG - Intergenic
1016141627 6:140619459-140619481 CAGCTAACACAATTTTGAGGGGG - Intergenic
1017742959 6:157423215-157423237 CATTCATCCCATTTTTGAGGTGG - Intronic
1022131661 7:27410331-27410353 CAGACCACCCAATTTGAAAGTGG + Intergenic
1023196306 7:37642730-37642752 TAGAAAACCAAATTTGGAGGAGG - Intergenic
1026138087 7:67680925-67680947 CAGTCAGCCCAAGTGGTAGGAGG + Intergenic
1031616590 7:123888943-123888965 CTGTTAACCCAATTTGGGGAGGG - Intergenic
1032508399 7:132452993-132453015 CAGTGACCCCAATTAGGAGGAGG - Intronic
1033272304 7:139943598-139943620 AAGTCACCCCAATGAGGAGGTGG - Intronic
1034079097 7:148260234-148260256 CAGTCACCTCAATTAGGAGAGGG - Intronic
1036429932 8:8680806-8680828 CAGTTCACCCAAATGGGAGGAGG + Intergenic
1037293053 8:17371561-17371583 CAGTCAACACAAGTTAGAGATGG + Intronic
1038440429 8:27567575-27567597 CAGTGAACCCAGCTTTGAGGAGG - Intergenic
1040464085 8:47678582-47678604 CAGAGCACCCACTTTGGAGGGGG + Intronic
1042593880 8:70424925-70424947 CACTCCACCCATTTGGGAGGTGG - Intergenic
1045809332 8:106202679-106202701 CTGTCAACCCCCTTTGGATGTGG - Intergenic
1047021563 8:120780236-120780258 GAGGCAAGCCAATTTGGTGGTGG - Intronic
1052745680 9:32438458-32438480 CAGTCAGCCCAAGTTGGAACGGG + Intronic
1054885093 9:70188067-70188089 TAGTCATCCCAAGTGGGAGGTGG + Intronic
1061477968 9:130881667-130881689 CAGCCAACCCATATTGGAGGTGG + Intronic
1061836668 9:133334049-133334071 CAGGCTACAAAATTTGGAGGAGG - Intronic
1185907237 X:3946747-3946769 CAGTTAACCCAATTGACAGGTGG - Intergenic
1187393077 X:18898241-18898263 CAGTCCAGCCAATGTTGAGGTGG - Intronic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1188735986 X:33716878-33716900 CAGTCAACCCAGTTTTAAGATGG - Intergenic
1189218501 X:39348650-39348672 CAGTCAACATAATATGGAGTGGG + Intergenic
1189233373 X:39469481-39469503 GAATCAACCTCATTTGGAGGGGG + Intergenic
1192730021 X:73793817-73793839 TAGAGAACCCAATTTGAAGGAGG + Intergenic
1197812692 X:130461548-130461570 CAATGAACCAATTTTGGAGGTGG - Intergenic
1200408813 Y:2841757-2841779 CAGGAAACCCGATTTGGAGAGGG + Intronic