ID: 956267833

View in Genome Browser
Species Human (GRCh38)
Location 3:67417709-67417731
Sequence CTTTCTCTGCTGGAGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 630}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956267833_956267838 -5 Left 956267833 3:67417709-67417731 CCCTTTTCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 43
4: 630
Right 956267838 3:67417727-67417749 GAAAGGCACCTTATGTAATGTGG 0: 1
1: 0
2: 1
3: 10
4: 120
956267833_956267843 6 Left 956267833 3:67417709-67417731 CCCTTTTCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 43
4: 630
Right 956267843 3:67417738-67417760 TATGTAATGTGGGCATGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 60
956267833_956267842 5 Left 956267833 3:67417709-67417731 CCCTTTTCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 43
4: 630
Right 956267842 3:67417737-67417759 TTATGTAATGTGGGCATGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 90
956267833_956267841 4 Left 956267833 3:67417709-67417731 CCCTTTTCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 43
4: 630
Right 956267841 3:67417736-67417758 CTTATGTAATGTGGGCATGCCGG 0: 1
1: 0
2: 1
3: 6
4: 111
956267833_956267839 -4 Left 956267833 3:67417709-67417731 CCCTTTTCCTCCAGCAGAGAAAG 0: 1
1: 0
2: 2
3: 43
4: 630
Right 956267839 3:67417728-67417750 AAAGGCACCTTATGTAATGTGGG 0: 1
1: 0
2: 0
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956267833 Original CRISPR CTTTCTCTGCTGGAGGAAAA GGG (reversed) Intronic
901068538 1:6506134-6506156 GTTTCTCTACTGGAGGAAGCGGG - Intronic
901331998 1:8417272-8417294 TATTCTCTGCTGCAGGAATATGG + Intronic
901508100 1:9699375-9699397 CTTTGGCTGCTGTGGGAAAATGG - Intronic
905043445 1:34978192-34978214 CTGTCTTTGCTGCAGTAAAATGG + Intergenic
905323445 1:37133565-37133587 CTCTCTCTGCTGGAGATGAAAGG - Intergenic
906044441 1:42817125-42817147 TTCCCTCTCCTGGAGGAAAATGG + Exonic
906830411 1:49025329-49025351 CTTTCTGTGCTGGAGACAGAGGG - Intronic
908135110 1:61123982-61124004 CTTTCTCAGCTTCAAGAAAAAGG - Intronic
909359500 1:74744337-74744359 CTCTCTCTGATGGGGAAAAATGG - Intronic
909759607 1:79271337-79271359 CTTTGTCTGCTGGAGAATATGGG - Intergenic
910106546 1:83637158-83637180 CTTTATCTGGTGGAGGCAACCGG + Intergenic
910170615 1:84372894-84372916 TTTTTTCTGCTGAAGGAGAAGGG + Intronic
910504737 1:87937130-87937152 CTTTCCCAGATTGAGGAAAACGG + Intergenic
910693730 1:89990814-89990836 ATTTCTTTGCCAGAGGAAAACGG + Intergenic
910772342 1:90842740-90842762 CTTTCTAGGCTGGAGTGAAAAGG + Intergenic
911129861 1:94376948-94376970 CTCTCTCTGCTGGGGAAAAATGG - Intergenic
911583765 1:99666692-99666714 CTTTTTCTCCTGGAATAAAAGGG - Intronic
911709765 1:101057088-101057110 CCTTCTCAGCTGGAGAAAATAGG + Intergenic
911845711 1:102748234-102748256 CTCTCTCTGATGGGGAAAAATGG - Intergenic
912633311 1:111267919-111267941 TTTTCTCTGCTTGAGGAGAGGGG - Intergenic
912841313 1:113041947-113041969 CCATCTCTGCTGGAGGGGAAAGG + Intergenic
912906631 1:113714536-113714558 ATTCCTCTGCTTGAGGAAACGGG + Intronic
912972754 1:114299531-114299553 CTTTCTCTGCTGCCGCAAGAGGG - Intergenic
913382533 1:118227405-118227427 CTCTCTCTGATGGGGAAAAATGG + Intergenic
915260474 1:154673359-154673381 CTCTCTCTGATGGGGAAAAATGG + Intergenic
915288244 1:154866513-154866535 CCCTCTCTCCTGGAGGCAAATGG - Intronic
915689512 1:157675025-157675047 CTTTCTCTGCTTTAGCAAAATGG + Intronic
916083535 1:161252001-161252023 CTCTCTCTGTTGGGGAAAAATGG + Intergenic
916114348 1:161474437-161474459 CTCTCTCTGATGGGGAAAAATGG + Intergenic
916266110 1:162891318-162891340 CTTAGACAGCTGGAGGAAAAGGG + Intergenic
916590152 1:166182317-166182339 CTTTTTCTGCTTAAGGTAAATGG + Intergenic
917279796 1:173369720-173369742 CTTCCTCTGATGGGGAAAAATGG + Intergenic
917281060 1:173378566-173378588 CTCTCTCTGATGGGGAAAAATGG + Intergenic
917628065 1:176865719-176865741 CTTTCTCAGCAGCATGAAAACGG - Intronic
918750261 1:188261858-188261880 CTCTCTCTGATGGGGAAAAATGG - Intergenic
919125915 1:193393724-193393746 ATTTATCTGCTGGAGTGAAAGGG + Intergenic
919206201 1:194423867-194423889 CTCTCTCTGATGGGGAAAAATGG + Intergenic
920212038 1:204335391-204335413 CTTTCTCTGCTGGGGAAGGAAGG - Intronic
920281127 1:204844518-204844540 CTTTCTCTACTGGAATATAAGGG - Intronic
920530720 1:206700274-206700296 CTCTCTCACCTGGAGGACAAAGG - Intronic
921019609 1:211224051-211224073 CTCTCTCTGATGGGGAAAAATGG + Intergenic
921424242 1:214984028-214984050 CTTTATCAGCAGGATGAAAACGG + Intergenic
921519211 1:216138731-216138753 CTTTTTCTGATGAAAGAAAAGGG + Intronic
922688045 1:227663324-227663346 CTTTCAATGCTGGTGGAAACTGG - Intronic
923295227 1:232588027-232588049 CTTTATCAGCAGCAGGAAAACGG + Intergenic
923588090 1:235293848-235293870 ATTTTTCTGGTGGAGGAGAAAGG - Intronic
924765174 1:247025507-247025529 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1063404943 10:5784813-5784835 CTTACTCTGGTGGAGGTAACAGG + Intronic
1063414707 10:5864040-5864062 CTCTCTCTGATGGGGAAAAATGG + Intronic
1063458312 10:6200712-6200734 CTTGCTCTGCAGCAGGCAAAAGG - Intronic
1063859174 10:10289846-10289868 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1063878077 10:10500652-10500674 CTTTCTCAGCAGCATGAAAATGG + Intergenic
1063885077 10:10569163-10569185 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG + Intronic
1066448020 10:35501598-35501620 CTGTCTGTGATGGATGAAAATGG + Intronic
1066614660 10:37282759-37282781 CTCTCTCTGATGGGGAAAAATGG - Intronic
1066990618 10:42509872-42509894 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1067746973 10:48943314-48943336 CTGTCTCTTCTGGTAGAAAAGGG + Exonic
1068173113 10:53421936-53421958 CCTGCTCTGGTGGAGGTAAAAGG + Intergenic
1068310740 10:55271386-55271408 TTTTCTCTGATGGTTGAAAAAGG + Intronic
1069461795 10:68602311-68602333 CTATCTCTGTTGGAAGGAAAAGG - Intronic
1070347374 10:75558073-75558095 CTTTCTCTGGAGGAGGGTAAGGG - Intronic
1070864972 10:79703038-79703060 TTTTCTTTCCTGGAGGAAACAGG - Intergenic
1070878761 10:79841169-79841191 TTTTCTTTCCTGGAGGAAACAGG - Intergenic
1071342013 10:84658101-84658123 CTTTCCCACATGGAGGAAAATGG + Intergenic
1071430323 10:85601894-85601916 CCCTCTCTGCTGGGGGAGAAGGG - Exonic
1071631867 10:87225259-87225281 TTTTCTTTCCTGGAGGAAACAGG - Intergenic
1071645321 10:87357479-87357501 TTTTCTTTCCTGGAGGAAACAGG - Intergenic
1071834775 10:89408234-89408256 CTCTCTCTGATGGGGAAAAATGG + Intronic
1071896739 10:90076054-90076076 CTCCTTCTGCTTGAGGAAAAAGG - Intergenic
1072371735 10:94771507-94771529 CTCTCTCTGATGGGGAAAAATGG - Intronic
1073227793 10:101938350-101938372 CTTTCTTAGCTGTCGGAAAAAGG + Intronic
1073964630 10:108974831-108974853 ATTTCTCTGGTGGAGGAGAGAGG + Intergenic
1074609119 10:115004359-115004381 CATCCTCTACTGGAGGAAGAAGG - Intergenic
1074612953 10:115038914-115038936 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1074742758 10:116500730-116500752 CTCTCTCTGATGGAGAAAAATGG + Intergenic
1074883542 10:117677152-117677174 AGTTCTCTGCTGTAGGGAAAGGG + Intergenic
1074980364 10:118614854-118614876 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1075146253 10:119885384-119885406 CTCTCTCTGATGGGGAAAAATGG + Intronic
1075292575 10:121242965-121242987 CTTCCACTGCTGGAGCAGAAAGG + Intergenic
1075351054 10:121725686-121725708 CAGTCTTTGCTAGAGGAAAAAGG - Intergenic
1075976209 10:126697718-126697740 CTTTATCTGCAGCATGAAAATGG + Intergenic
1077667606 11:4127737-4127759 CTTTGTCCTCTGGAGTAAAAAGG + Intronic
1078184100 11:9036979-9037001 CTTTCTCTCTGGAAGGAAAATGG - Intronic
1078573055 11:12475904-12475926 CTTTCTGTGCAGGAAGAAGATGG + Intronic
1079214257 11:18493085-18493107 CTGACTCTGCTTGAGTAAAAAGG - Intronic
1079731307 11:23939719-23939741 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1079811740 11:25005441-25005463 CTCTCTCTGATGGGGAAAAAAGG - Intronic
1079966281 11:26984025-26984047 CTTCCTTGGCTGGGGGAAAAGGG + Intergenic
1080088403 11:28315023-28315045 CTTTATCTGCAGCATGAAAATGG + Intronic
1081033349 11:38113351-38113373 CTGTCTCTGATGGGGAAAAATGG + Intergenic
1081131264 11:39383179-39383201 CTTTCTGTGCTGCAAGTAAAGGG - Intergenic
1081437397 11:43041849-43041871 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1081515204 11:43822147-43822169 CCTTCTCTGCTCTAAGAAAAAGG - Intronic
1081663083 11:44900276-44900298 CTGTCCCTGCTGGAGAATAATGG + Intronic
1083065992 11:59924401-59924423 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1083496066 11:63054685-63054707 GTTTCCCTACTGCAGGAAAAAGG + Intergenic
1084276497 11:68054000-68054022 CTTCCTCTTCTGGTGGAAATAGG + Exonic
1084937551 11:72595231-72595253 CCTTCTCTGCTGAGGGCAAAGGG - Intronic
1085955598 11:81390016-81390038 CTTCCTCTGGTCGAGGAAAATGG - Intergenic
1086317310 11:85608354-85608376 CTCTCTCTGATGGGGAAAAATGG + Intronic
1086599499 11:88615481-88615503 CCTTCTCTGGTGGAGGAAGAAGG - Intronic
1087319184 11:96638252-96638274 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1087683411 11:101238807-101238829 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1088492467 11:110401244-110401266 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1089914846 11:122143785-122143807 CATTCTTTGCTGGATGAAGAAGG + Intergenic
1090049291 11:123363121-123363143 CTCCCTCTGCCAGAGGAAAACGG - Intergenic
1090072465 11:123555771-123555793 CTTACTCAGCTGGAGCACAATGG + Intronic
1090239556 11:125172401-125172423 CTCTCTCTGCTTAGGGAAAAAGG - Intronic
1090368785 11:126231001-126231023 CTATCTCTGGTGGATGAAAAAGG - Intronic
1091154804 11:133362577-133362599 CTCTCTCTGATGGAGATAAATGG + Intronic
1091393725 12:141192-141214 CTTTCGCTGGAGGAGGAAATGGG - Exonic
1091918368 12:4285260-4285282 CTCTCTCTGCTGCAGGAGGAAGG + Intronic
1092192595 12:6532001-6532023 CTCTCTCTGCTGCATGAAACTGG - Intergenic
1093224094 12:16460303-16460325 CATTTTCTGCTGGAGGAATCGGG + Intronic
1093249055 12:16777818-16777840 CTTTCTCATCTGCAGGCAAACGG - Intergenic
1093673635 12:21907231-21907253 ATTTGTGTGCTGGAGTAAAAAGG + Intronic
1094248803 12:28335445-28335467 CTTGCTCTGCTGGAGCGCAATGG + Intronic
1094320041 12:29173558-29173580 CTCTCTCTGATGGAGAAAAATGG - Intronic
1094338182 12:29383897-29383919 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1094482587 12:30896529-30896551 TTTTCTGTGCTGGAGGAGACTGG - Intergenic
1094694304 12:32802402-32802424 CTTTCTCTGCAGAATGAAATTGG - Exonic
1094798152 12:34000439-34000461 CTTTGCCTCCTGGAGGAGAATGG - Intergenic
1095465253 12:42483105-42483127 TGTTCTATGCTGGAGGACAAGGG - Intronic
1095744256 12:45640003-45640025 CTTTATCAGCTGCATGAAAATGG - Intergenic
1096171394 12:49473907-49473929 CTTTATCAGCAGCAGGAAAACGG - Intronic
1096208450 12:49742858-49742880 CTGTCCCTACTGGAGGAAAGTGG - Intronic
1097428223 12:59472725-59472747 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1097474958 12:60042343-60042365 CTTTCTCTCCTGAAAGAAATGGG + Intergenic
1097831883 12:64233562-64233584 TTTTCTCTCATGGATGAAAAAGG - Intergenic
1098840778 12:75475722-75475744 CTTTATCAGCAGGATGAAAATGG - Intergenic
1099052762 12:77801567-77801589 CTTTCTCTGGTGAATAAAAATGG + Intergenic
1099376181 12:81898289-81898311 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1099414813 12:82372600-82372622 CTCTCTCTGATGGGGAAAAATGG - Intronic
1099576933 12:84393750-84393772 ATTTCTCTGATGGGGAAAAATGG - Intergenic
1099879198 12:88446289-88446311 CTTTATCAGCAGCAGGAAAAAGG - Intergenic
1099990653 12:89717445-89717467 CTTTCTCTGAGGCAGAAAAAAGG + Intergenic
1100209714 12:92388447-92388469 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1100530378 12:95456480-95456502 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1100665322 12:96745950-96745972 GTTTCTCTGCAGTGGGAAAACGG + Intronic
1100960032 12:99952590-99952612 CTTTCTCTGCTGTGGGAAGTTGG - Intronic
1101501484 12:105308361-105308383 CTTTCTTTTCTGGAGGACACTGG - Intronic
1101579177 12:106026523-106026545 CTCTCTGTGATGGAGGAAGATGG - Intergenic
1101590858 12:106124084-106124106 CTTTTTCTGCTTGAAGCAAAGGG + Intronic
1101779590 12:107823577-107823599 CTCTCTTTGATGGGGGAAAATGG + Intergenic
1102693613 12:114781010-114781032 CTTTCTCTTCTGGAGCCAAGTGG - Intergenic
1102832123 12:116012679-116012701 TCTTCTCTACTGGAGGAGAATGG + Intronic
1103820760 12:123696364-123696386 CTTGCTATGCTGGAGGAAACAGG + Intronic
1104233877 12:126912638-126912660 CTTGCCCTGAAGGAGGAAAATGG + Intergenic
1105954564 13:25268629-25268651 CTTGATCTGCAGGAAGAAAAGGG - Intronic
1106144709 13:27040643-27040665 CTTTCTCTTGTGGAAGTAAATGG + Intergenic
1106162616 13:27214576-27214598 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1107817163 13:44254516-44254538 TTTTCCCTTCTTGAGGAAAAAGG + Intergenic
1108059733 13:46520500-46520522 CATTGTCAGCTGGAGGAAACAGG - Intergenic
1108438140 13:50421493-50421515 TTTTTTCCCCTGGAGGAAAAGGG + Intronic
1109500960 13:63235739-63235761 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1110137138 13:72081603-72081625 CTTTCTGTGCTGCATAAAAAAGG + Intergenic
1110323480 13:74186651-74186673 TTTTCTATCATGGAGGAAAATGG - Intergenic
1110559867 13:76899260-76899282 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1110655283 13:77990964-77990986 TATACTCTCCTGGAGGAAAAAGG - Intergenic
1110690794 13:78428240-78428262 CTATCTCTGCTGGAAGCAAGAGG + Intergenic
1112003735 13:95236188-95236210 TTTTCTTTGTTGGGGGAAAAGGG - Intronic
1112312764 13:98334161-98334183 CTTTCCAGGCTGGAGGACAACGG - Intronic
1112758252 13:102664548-102664570 CATTCCCTGCTGGAGTACAATGG - Intronic
1113064339 13:106358508-106358530 CTTTATCTGCAGCATGAAAATGG + Intergenic
1113178974 13:107602921-107602943 CTTTCTCTTCTGCATGAAGAAGG + Intronic
1113203997 13:107895457-107895479 CTCTCTCTGATGGAGAAAAATGG - Intergenic
1113310403 13:109126548-109126570 TTTTCTCTGCTGGAACTAAACGG + Intronic
1113694846 13:112337652-112337674 CATTCTCTGATGAAGAAAAATGG + Intergenic
1114317957 14:21524849-21524871 CTTTCTCTGCTGGAGGGGTTGGG - Exonic
1115021434 14:28685244-28685266 CTTTATCAGCTGCATGAAAACGG + Intergenic
1115285534 14:31710080-31710102 CTCTCTCTGATGGGGAAAAATGG - Intronic
1115638724 14:35317279-35317301 CTCTCTCTGCTAGAGCAACAAGG - Exonic
1115749057 14:36469948-36469970 GTATGGCTGCTGGAGGAAAATGG + Intergenic
1116891063 14:50268870-50268892 TTCTCTCTGGTGGAGGGAAAGGG - Intronic
1118611935 14:67548012-67548034 CCTCCTCTACTGGAAGAAAAGGG - Intronic
1119072950 14:71606303-71606325 CTTCCTCTGCTGGAGGAAGGGGG + Intronic
1119272143 14:73316414-73316436 CTTCCTTTCCTGGAGGAACAGGG + Exonic
1119463864 14:74836890-74836912 TTTTCTTTGCAGGATGAAAAAGG - Intronic
1119610310 14:76056320-76056342 CTTCCTCTGTTGGGAGAAAAGGG + Intronic
1119726287 14:76923696-76923718 CTTTCTCTGAGGGAGGAACTAGG - Intergenic
1119760832 14:77150604-77150626 CTCTCTCTGCTGGAGGGCAGTGG + Intronic
1120183669 14:81370384-81370406 CTTTCTTTGCAGGTGGAATATGG - Intronic
1121219088 14:92272406-92272428 CTTTCTGTGCTAGATGAGAAGGG - Intergenic
1121262220 14:92574724-92574746 CCTGCTCTGCTGGAGGAGAGGGG + Intronic
1121263872 14:92586189-92586211 CTTTGTCTCCTGGATGAAATGGG + Intronic
1121807989 14:96848997-96849019 CTTCCTCTGCTACAGGAAGACGG - Intronic
1122392328 14:101398406-101398428 CTTTCTCTCCGTTAGGAAAATGG - Intergenic
1202843807 14_GL000009v2_random:148543-148565 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1202913210 14_GL000194v1_random:138787-138809 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1202879445 14_KI270722v1_random:43898-43920 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1124882683 15:33656854-33656876 GTTTTCCTGCTGGAGGAAGAAGG - Intronic
1126238872 15:46417961-46417983 TTTTCTCTCCTGGATGAAGATGG + Intergenic
1126456266 15:48865460-48865482 CTTTCTTTCCTATAGGAAAATGG - Intronic
1126805080 15:52340054-52340076 CTGTCTCTGCTGGAGTAAGAGGG + Intronic
1126923174 15:53550596-53550618 TTTTCTCTGCTGGAGCAGAGTGG - Intronic
1127823654 15:62683763-62683785 CTTTGTCTACTGGAGATAAAAGG + Intronic
1129589944 15:76905949-76905971 GTTTCCCAGCTGGATGAAAAGGG - Intergenic
1130091512 15:80824871-80824893 CTTTCTGAGCTGGAGAAAAGTGG - Intronic
1130672048 15:85921267-85921289 GGTTCTGGGCTGGAGGAAAATGG - Intergenic
1131411130 15:92209154-92209176 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1131443798 15:92478711-92478733 CTTTCCCTGCTGCTGGACAAGGG - Intronic
1131527057 15:93160707-93160729 TTTCCTCTGCTGGAGGAGACTGG + Intergenic
1131843496 15:96463988-96464010 CTTACGCTGCTGGATGAAATCGG - Intergenic
1131939533 15:97545748-97545770 CTTTCTGTGCTGTGAGAAAATGG - Intergenic
1131958321 15:97761978-97762000 GTTTCTCTGATGGCGGAACATGG + Intergenic
1133132829 16:3688362-3688384 CTTTGGCTGCCGGAGGAAGAAGG - Intronic
1133491079 16:6268814-6268836 TGTTCTCTGTTGGAGGAACAGGG - Intronic
1134447682 16:14343252-14343274 CTCTGTGAGCTGGAGGAAAATGG - Intergenic
1134801883 16:17091952-17091974 CTACTTTTGCTGGAGGAAAAGGG + Intergenic
1135339753 16:21635606-21635628 CTCTCTCTGATGGGGAAAAATGG - Intronic
1136982920 16:35074625-35074647 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1137423335 16:48354729-48354751 CTTTCTTTTCTGGAGGACACTGG - Exonic
1137541984 16:49369828-49369850 GTTTCTCTGCTGCAGTTAAAGGG + Intergenic
1137844742 16:51676136-51676158 CTTCCTCTGCTGTAAAAAAAGGG - Intergenic
1138358472 16:56405661-56405683 TTTTTTCTGCTGGTGGACAAAGG - Intronic
1139778645 16:69332726-69332748 CTATCTGAGCTGGTGGAAAAAGG + Exonic
1140014976 16:71173866-71173888 TTTTCTGTGCTGGAGAAAATAGG - Intronic
1140167532 16:72568956-72568978 CTATCTATGATGGAGAAAAAAGG + Intergenic
1140767059 16:78169750-78169772 CGTTGTTTGCAGGAGGAAAAGGG + Intronic
1140940479 16:79717463-79717485 GTTTCTCTGCTTCTGGAAAAGGG - Intergenic
1141274539 16:82574721-82574743 CTTACCCTGGTGGAGGAAAGAGG - Intergenic
1141864688 16:86741974-86741996 GTTTGTCTGCTGGAGGAAGAGGG - Intergenic
1142983184 17:3683142-3683164 CTCCCTCTGCTGGAGGAGAGGGG - Intronic
1143064405 17:4233771-4233793 CGTACTCTGCTGGAGGAAACAGG - Intronic
1144462692 17:15470415-15470437 CTTACTCAGCTGGAGGTAAAGGG - Intronic
1144468989 17:15520079-15520101 CTTCCTCAGCTGGAGGATGAAGG - Intronic
1144621135 17:16819159-16819181 CTTTCTGTGAGGGAGGGAAAGGG + Intergenic
1145014848 17:19389697-19389719 CTTTCTCTCCTGCATAAAAAAGG - Intergenic
1145801086 17:27685333-27685355 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1146101862 17:29990871-29990893 CTTTCTTTTCTGGAGGACACTGG - Intronic
1146293996 17:31633960-31633982 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1146482819 17:33218740-33218762 CCGTCCCTGCTGGAGGCAAAAGG - Intronic
1146772218 17:35579208-35579230 CTTGCTATACTGGATGAAAATGG + Intronic
1147438362 17:40431656-40431678 CTTTCCCTGCTGGAACAAATGGG + Intergenic
1147573113 17:41583452-41583474 CTTTCTGTGAGGGAGGGAAAGGG + Exonic
1147735075 17:42631550-42631572 TTTTTTCTGATGGAGGAACAGGG - Intergenic
1147856020 17:43480688-43480710 CCTTTTCTGCTGGGGTAAAATGG - Intergenic
1147970324 17:44215981-44216003 CTTCCTCACCTGGAGGAAGAGGG + Exonic
1148080515 17:44965596-44965618 CTGCCCCTGCTGGAGGGAAAAGG + Intronic
1149209590 17:54288085-54288107 CTCTCTCTGATGGAGAAGAATGG + Intergenic
1150203252 17:63378804-63378826 CATTCTCAGCTGGAGGGAAAGGG + Intronic
1150448870 17:65249065-65249087 GTTTGGGTGCTGGAGGAAAAAGG - Intergenic
1151843566 17:76635049-76635071 CTTTGTATGCTGGAAAAAAATGG + Intronic
1151997641 17:77620333-77620355 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1152533851 17:80939007-80939029 CTTTCTCTGATAGAAGAAATGGG - Intronic
1152559632 17:81071532-81071554 CTTTCTCTGCTGGTGGAAGAGGG - Intronic
1153437975 18:5087304-5087326 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1154934511 18:21038734-21038756 CTTTCTCTGATAGATGAACAGGG + Intronic
1155107105 18:22678211-22678233 CTTTCCTTGCTGGAGAAACATGG + Intergenic
1155476196 18:26237773-26237795 CTCTCTCTGATGGGGAAAAATGG - Intronic
1156465546 18:37346131-37346153 CTATGTCTGCTGGAGGATGAGGG + Intronic
1157431192 18:47628124-47628146 TTTTATCTGTTGCAGGAAAATGG + Intergenic
1157857980 18:51118642-51118664 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1157952531 18:52055734-52055756 CTTTCTCTGGTTATGGAAAATGG - Intergenic
1158027323 18:52915824-52915846 ATTTCTATGTTGAAGGAAAATGG + Intronic
1158414710 18:57239794-57239816 ATTTCTTTGCTGGAGAAGAAAGG + Intergenic
1159001935 18:62982081-62982103 CTGTGTCTGCTGCAGGAGAAAGG + Intergenic
1159136180 18:64339313-64339335 CACTCTGTTCTGGAGGAAAAAGG + Intergenic
1159890613 18:73949753-73949775 GTCTATCTGCTGGAGGAGAATGG - Intergenic
1159897514 18:74011436-74011458 CTGTCTCTGCTGATGGAGAATGG + Intergenic
1160818573 19:1047495-1047517 CTGGCTCTGCTGGAGGAGCAGGG + Exonic
1160841366 19:1148242-1148264 CTTTCTATGCAGGAGGAGAGTGG - Intronic
1161598310 19:5164074-5164096 CTCTCTCTGATGGGGAAAAATGG - Intronic
1162107841 19:8381319-8381341 CTCTCTCTGATGGGGAAAAATGG + Intronic
1162381003 19:10331948-10331970 CTTTATCAGCAGGAGGAAATTGG - Intronic
1162642526 19:12022860-12022882 CTTTCTTTTCTGGAGGACACTGG + Intronic
1162652754 19:12103398-12103420 CTTTCTTTTCTGGAGGACACTGG - Intronic
1163192090 19:15684804-15684826 CTTTCTCTTCAGGATGAAGATGG + Exonic
1163556563 19:17996804-17996826 CTTGCACTGATGGAGGGAAAAGG + Intronic
1164262027 19:23576429-23576451 CTTTCTTTTCTGGAGGACACTGG - Intronic
1164903474 19:31947787-31947809 CTTTCTCTTCTAGAGCCAAAAGG - Intergenic
1164993029 19:32698247-32698269 CTCTCTCTGATGGGGAAAAATGG - Intronic
1165757006 19:38299469-38299491 CCTTCTCCCCTGTAGGAAAAAGG - Intronic
1165847000 19:38824571-38824593 CTCTCTCTGATGGGGAAAAATGG + Intronic
1167234117 19:48303531-48303553 CCATCTGTGCTGGAGGAACAAGG - Intronic
1167245133 19:48368754-48368776 CTTTCCCTGGGGGAGGACAACGG - Intronic
1167602143 19:50460469-50460491 CTTCCTCTGGGGGATGAAAATGG - Intronic
1168508146 19:56953500-56953522 CTTTCTCTGTAAAAGGAAAATGG + Intergenic
1168725404 19:58578477-58578499 CTTTCCCTGCTGGACCAATAGGG - Intergenic
1202655063 1_KI270708v1_random:12907-12929 CTTTCTTTTCTGGAGGACACTGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925478858 2:4248083-4248105 CTTTATCAGCAGCAGGAAAATGG - Intergenic
925747675 2:7057390-7057412 CTTTCTAATCTGGAGGAAATTGG + Intronic
925949976 2:8900856-8900878 CTCTCTCTGATGGGGAAAAATGG - Intronic
926020580 2:9491624-9491646 CATGCTCTGCTGGAGGAACTGGG + Intronic
926502569 2:13674091-13674113 CTTTATCAGCAGGATGAAAATGG - Intergenic
927220096 2:20698891-20698913 TTTTATATGCTTGAGGAAAATGG - Intronic
927905863 2:26855786-26855808 CTTGCTCTGCAGAAGGACAAAGG - Intronic
928121846 2:28589433-28589455 CTTCTCCTGCAGGAGGAAAAGGG - Exonic
928617712 2:33056136-33056158 CTCTCTCTGATGGGGAAAAACGG - Intronic
928863908 2:35895248-35895270 ATTTTTCTGCTCGAGGAAAGGGG - Intergenic
928904875 2:36357268-36357290 CTTTCTCTCCTGAAAGGAAAGGG + Intronic
928927295 2:36593101-36593123 CTTTATCAGCTGCATGAAAATGG - Intronic
928932391 2:36637553-36637575 TTTTCTCTGCTTGAGGAAAGGGG + Intronic
929023558 2:37577492-37577514 ATTTCTTTGCTGGAGGCAGAGGG - Intergenic
929330291 2:40674009-40674031 CTCTCTCTGATGGGGAAAAATGG + Intergenic
929687600 2:44047889-44047911 CTTTCTCAGCAGCATGAAAACGG - Intergenic
929932123 2:46266073-46266095 CTTTCTCTGATGGGGGAAATTGG - Intergenic
930038437 2:47102428-47102450 CTCTCTCTGATGGGGAAAAATGG + Intronic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
931355726 2:61537055-61537077 GTTTCCTTGCTGGAGGAACAGGG + Intronic
931452742 2:62382013-62382035 TTATCTCTGCTGGTAGAAAATGG + Intergenic
931540397 2:63324094-63324116 CTCTCTCTGATGGGGAAAAATGG + Intronic
931639376 2:64368522-64368544 ACTTCTCTGTTTGAGGAAAATGG + Intergenic
932048759 2:68378426-68378448 GTTTCTCTTCTGGTGGAATAAGG - Intronic
932536040 2:72596489-72596511 CTTTCTCTGCTGGAAGCAGGAGG - Intronic
932803278 2:74761750-74761772 CTTCCTCTCCTGGAGGGAGAGGG - Intergenic
933146968 2:78865493-78865515 CTTTTTGTCCTGGAGGGAAAGGG - Intergenic
933474383 2:82770776-82770798 CTTTCTCTCTTGGAGGAGGAGGG - Intergenic
933701179 2:85256376-85256398 CTTTCTCTGTTGGAGGATTTGGG + Intronic
935113543 2:100113828-100113850 CCTTCTCTGCTAGGGGAACATGG - Intronic
935174519 2:100638188-100638210 CTTTCCATGCTGGAAGAAACCGG - Intergenic
935449026 2:103188322-103188344 CTTTATCAGCTGCATGAAAACGG + Intergenic
935915763 2:107947770-107947792 CTTTCTTTTCTGGAGGACACTGG - Intergenic
936595778 2:113846113-113846135 CTTTATCAGCAGCAGGAAAATGG + Intergenic
938119683 2:128624774-128624796 GTCTCTCTGCTGAAGGAAGAAGG + Intergenic
938849895 2:135249856-135249878 CTTTATCTGCAGCATGAAAATGG + Intronic
939352075 2:141051638-141051660 CTTTCTCAGTTGGAGGAGAATGG - Intronic
939669198 2:144988817-144988839 CTGTCTTTGTTGGAGGAAATGGG + Intergenic
939711736 2:145529699-145529721 CTTTTACTGCTTGAGGATAATGG + Intergenic
939851770 2:147313232-147313254 CTTTCTCTGATGGGGAAAAATGG + Intergenic
940402288 2:153261799-153261821 ACTCCTCTGCTTGAGGAAAAGGG - Intergenic
940638691 2:156327323-156327345 TTTTCACAGCTGGAGTAAAAAGG + Intronic
941424937 2:165331195-165331217 GTTAATCTGCTGGAGGAACAGGG - Intronic
941470178 2:165874622-165874644 CAACCTCTGCTGGAGAAAAAAGG + Exonic
941509607 2:166389435-166389457 CTTTATCAGCAGGATGAAAATGG - Intergenic
941537635 2:166742314-166742336 CTCTCTCTGATGGGGAAAAATGG - Intergenic
942041103 2:172063697-172063719 CTTTATGTGCTTGAGGAAAAAGG - Exonic
943103156 2:183511095-183511117 CTCTCTCTGATGGGGAAAAATGG - Intergenic
943215436 2:185027753-185027775 CTTTATCAGCAGGATGAAAACGG - Intergenic
943600752 2:189918363-189918385 CATTCTCAGATGAAGGAAAAGGG - Intronic
944174056 2:196810048-196810070 CTTTGTGTTCTGGATGAAAAAGG - Exonic
944351812 2:198736916-198736938 ATTTCTTTGCAGGTGGAAAATGG + Intergenic
945979219 2:216295638-216295660 CTTTCTTTGCTTGTGGACAAGGG + Intronic
946207445 2:218120087-218120109 CTTTCTCTGATGGGGAAAAATGG - Intergenic
1169142581 20:3234612-3234634 CATTCTCTGCCGGAGAAAAGCGG + Exonic
1169360920 20:4948233-4948255 CTTTCTCTGCAGGTGAAAGAAGG - Intronic
1169403555 20:5304103-5304125 CTTTCTTTTCTGGAGGACACTGG + Intronic
1170628525 20:18048331-18048353 CTCTCTTTGATGGAAGAAAAGGG + Intronic
1170781667 20:19431014-19431036 GTATCTCTGCTGGGGGCAAAAGG + Intronic
1171229081 20:23467784-23467806 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1171261424 20:23737775-23737797 CTCTCTCTGAAGGGGGAAAATGG + Intergenic
1172340560 20:34154279-34154301 CTATCTCTGATGGGGAAAAATGG + Intergenic
1174497056 20:50954258-50954280 GGTTCTCTACTGGAGGCAAAGGG + Intronic
1174731258 20:52920346-52920368 ATTACTTTGCTCGAGGAAAAGGG + Intergenic
1174760482 20:53202133-53202155 CTTTTGCTGCTGGAGGACAAAGG + Intronic
1174778344 20:53365903-53365925 CTTTTTGTGCTGGAGGCAACAGG - Intronic
1175221272 20:57418019-57418041 CTAACTCTGCTGGAGTAGAAGGG - Intergenic
1175257268 20:57654989-57655011 CTTTCTCTCCTGGAGGCAGCGGG - Intronic
1175650609 20:60718732-60718754 ATCTATCTGCTGGAGGATAATGG - Intergenic
1176632559 21:9153457-9153479 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1177473765 21:21592980-21593002 CTTTCTCAGCAGCATGAAAATGG - Intergenic
1178998072 21:37425676-37425698 CTGTCTCTTCTAGAGGAAAATGG - Intronic
1179162412 21:38909309-38909331 CTATCTCAGCAGGAGGGAAAAGG + Intergenic
1179353037 21:40631490-40631512 CTGAGTCAGCTGGAGGAAAACGG - Intronic
1180349775 22:11790745-11790767 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1180613868 22:17114884-17114906 CTTTCTCGGCCTCAGGAAAATGG + Exonic
1180692613 22:17729872-17729894 CTTCCACTGCTGGAGGCAGAGGG - Intronic
1182024769 22:27109462-27109484 CTTTATCTGCAGCATGAAAATGG - Intergenic
1182235575 22:28873549-28873571 CTGTTGCTGCTGCAGGAAAAAGG - Intergenic
1182815339 22:33157095-33157117 CTTTATCAGCAGGATGAAAATGG + Intergenic
1183697527 22:39431584-39431606 CCTGCTCTGCCGCAGGAAAATGG - Exonic
1184994588 22:48196148-48196170 CTTTATCAGCAGGATGAAAATGG + Intergenic
949449060 3:4165671-4165693 CTCTCTCTGATGGGGAAAAATGG - Intronic
949976931 3:9469368-9469390 CTTTCTCTTCAAGAGAAAAAAGG - Intronic
950525344 3:13519691-13519713 CTGTCTCAGCTGCAGGAACATGG + Intergenic
950943459 3:16918667-16918689 CTTTATGTGTTGAAGGAAAAAGG + Intronic
951020402 3:17776317-17776339 CTCTCTCTGATGCAGAAAAATGG + Intronic
951270657 3:20619596-20619618 CTTTCTTTTCTGGAGGACACTGG - Intergenic
951354039 3:21642274-21642296 CTTTCTCTGCTGCAGAGAAAGGG - Intronic
951773349 3:26282830-26282852 CTTTATCAGCAGGATGAAAATGG - Intergenic
952452933 3:33448493-33448515 CTCTCTCTGATGGGGAAAAATGG + Intergenic
952555138 3:34522453-34522475 CTCTCTCTGATGGGGAAAAATGG - Intergenic
952941041 3:38444601-38444623 CTCTCTCTGATGGGGAAAAATGG - Intergenic
953832587 3:46313239-46313261 GTTGCTCTGCTGGAGGAGTATGG - Intergenic
953864538 3:46572878-46572900 CCTTCTTTGCTGGGGGAAGAGGG + Intronic
954586891 3:51744170-51744192 CTCTCTCTGATGGGGAAAAATGG + Intergenic
955747776 3:62157050-62157072 CCTTCTCTGTTTGGGGAAAAAGG - Exonic
956267833 3:67417709-67417731 CTTTCTCTGCTGGAGGAAAAGGG - Intronic
956327235 3:68067437-68067459 CCTCCACTCCTGGAGGAAAAAGG - Intronic
956843055 3:73157652-73157674 CTCTCTCTGATGGGGAAAAATGG - Intergenic
956902335 3:73729885-73729907 CTTTCTCTGCTTGTGGAGAGTGG + Intergenic
956967723 3:74482759-74482781 CTGTCTTTGCTGCAGGCAAATGG - Intronic
957099409 3:75809253-75809275 CTTTCTTTTCTGGAGGACACTGG - Intergenic
957527074 3:81391504-81391526 CTTTATCAGCAGCAGGAAAATGG - Intergenic
958147174 3:89640441-89640463 ATTTCTCTGCTTGAGGAAAAAGG + Intergenic
958549309 3:95593634-95593656 CTCTCTCTGATGGGGAAAAATGG - Intergenic
958575902 3:95949729-95949751 CTCTCTCTGATGGTGAAAAATGG - Intergenic
958601298 3:96299636-96299658 CTCTCTCTGATGGGGAAAAATGG + Intergenic
958692467 3:97485231-97485253 CTTGTCCTTCTGGAGGAAAAAGG - Intronic
958988433 3:100811510-100811532 CTTTCTCTGCTGAAGTCTAAAGG - Intronic
959342659 3:105150067-105150089 CTTTATCAGCTGCATGAAAATGG - Intergenic
960063596 3:113348376-113348398 CTCTCTCTGATGGGGAAAAATGG + Intronic
960067376 3:113387950-113387972 ACTTCTCTGCTTGTGGAAAAGGG + Intronic
960789041 3:121406402-121406424 CTTTCTCTGCATGATGTAAAAGG + Intronic
960835432 3:121901754-121901776 CTTCATTTGCTAGAGGAAAATGG + Intronic
961261571 3:125606215-125606237 CTCTCTCTGATGGGGAAAAATGG + Intergenic
961329371 3:126129696-126129718 TTTTCCCTGCTAGAGGAAACTGG - Intronic
961687569 3:128644976-128644998 CTTTTTCTGTTGTAGGTAAAGGG - Exonic
961981345 3:131082466-131082488 CTTTCTGTGCTGATGGAAATGGG + Intronic
963696649 3:148572694-148572716 CTCTCTCTGATGGGGAAAAATGG + Intergenic
964972150 3:162576377-162576399 CTCTCTCTGATGGGGAAAAATGG + Intergenic
965474230 3:169134378-169134400 CTTTATTTACTGGAGGTAAAAGG + Intronic
965719806 3:171649365-171649387 TTTTCACTGCTGTAGAAAAAAGG + Intronic
965960669 3:174425049-174425071 CTGTCTCTCCTGGAGGGCAAGGG + Intergenic
966718080 3:183034044-183034066 CTTCCACTGCTAGACGAAAATGG + Exonic
966863793 3:184245121-184245143 CTCCCTCTGCTGCAGGAAATTGG + Intronic
967583525 3:191187293-191187315 CTCTCTCTGATGGGGAAAAATGG + Intergenic
967666595 3:192180128-192180150 CTTTCTCTGGTAGAGGAATTTGG + Intronic
1202746142 3_GL000221v1_random:103662-103684 CTTTCTTTTCTGGAGGACACTGG - Intergenic
968707415 4:2086597-2086619 TATTCTCTTCTGGAGGAAAATGG - Intronic
969274616 4:6127127-6127149 CTCTTTCTTCTGGGGGAAAATGG + Intronic
971281303 4:25244519-25244541 CTCTCTCTGATGGGGAAAAATGG - Intronic
972080225 4:35140611-35140633 CTTTCTTTTCTGGAGGACACTGG + Intergenic
972133396 4:35863339-35863361 CTCTCTCTGATGGGGAAAAAGGG - Intergenic
972767168 4:42161958-42161980 CTTTCTTGGCTGGGGGCAAATGG - Intergenic
972850011 4:43036579-43036601 CTTTATCAGCAGGGGGAAAATGG + Intergenic
973606008 4:52588426-52588448 CCTTCTCTGCTGGAGCAAATTGG + Intergenic
973643417 4:52926005-52926027 CTCACTCTGCTGAAGGAAAGGGG - Intronic
974174397 4:58306212-58306234 CTCTCTCTGATGGGGAAAAATGG + Intergenic
974563580 4:63553982-63554004 CTTTCTCAGCAGTATGAAAATGG - Intergenic
974838944 4:67280442-67280464 CTCTCTCTGATGGGGAAAAATGG - Intergenic
975047897 4:69826695-69826717 CTCTCTCTGATGGGGAAAAATGG + Intronic
975595943 4:76048324-76048346 CTCTCTCTGATGGGGAAAAATGG - Intronic
976444965 4:85119107-85119129 CTTTATCAGCAGCAGGAAAATGG + Intergenic
976557040 4:86461778-86461800 CTTTCTTTTCTGGAGGACACTGG + Intronic
976620420 4:87121240-87121262 CTCTCTCTTCAGGAGGAAAAAGG - Intronic
976977861 4:91186141-91186163 CTTTCTTTTCTGGAGGACACTGG - Intronic
977016787 4:91701109-91701131 CTTTCTTTTCTGGAGGACACTGG - Intergenic
977048809 4:92100929-92100951 CCTTCTGTACTGGAAGAAAAAGG - Intergenic
977642015 4:99367926-99367948 CTTTCTTTTCTGGAGGACACTGG + Intergenic
977832422 4:101609250-101609272 CTTTATCAGCAGGATGAAAATGG + Intronic
977835017 4:101636412-101636434 CTCTCTCTGATGGGGAAAAATGG - Intronic
977867615 4:102048680-102048702 CTCTATATGCTGGAGGGAAAAGG + Intronic
977883996 4:102237168-102237190 CTCTCTCTGATGGGGAAAAATGG + Intergenic
978747078 4:112207311-112207333 CTCTCTCTGATGGGGAAAAATGG + Intergenic
979369062 4:119862062-119862084 CTTTCTCAGCAGCATGAAAATGG - Intergenic
979982745 4:127276590-127276612 CTTTCTTTTCTGGAGGACACTGG - Intergenic
980008118 4:127564640-127564662 CTGTATCTTCTAGAGGAAAAGGG + Intergenic
980290993 4:130847355-130847377 CTCTCTCTGATGGGGAAAAATGG - Intergenic
980871310 4:138614233-138614255 CTTTCTCTGCTCCAGGAGGAAGG + Intergenic
981565732 4:146099451-146099473 CTTCTGCTGCTGGAGGAATAAGG - Intergenic
982316659 4:154038611-154038633 CTTTTTCTTCTGCAGGAAAAAGG - Intergenic
982701027 4:158659838-158659860 CTCTCTCTGATGGAGAAAAATGG + Intergenic
983012232 4:162562290-162562312 CTTTCACTGCTGGGGAAGAATGG - Intergenic
983427937 4:167610386-167610408 CTTTCTTTTGTGGAGGAGAAGGG - Intergenic
983835025 4:172375312-172375334 CTCTCTCTGATGGGGAAAAATGG - Intronic
984211201 4:176850861-176850883 CCTTTTCTGTTGGAAGAAAATGG + Intergenic
984483553 4:180336843-180336865 GTTTAGCTGCTGGAGAAAAAAGG + Intergenic
984917348 4:184736295-184736317 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1202755640 4_GL000008v2_random:59634-59656 CTTTCTTTTCTGGAGGACACTGG + Intergenic
986364222 5:7014139-7014161 CTGTCACTGTTGGAGGAAAATGG + Intergenic
986467129 5:8037123-8037145 CTTTCTTTTCTGGAGGACACTGG - Intergenic
987062934 5:14259536-14259558 CTTTTTCTGCTTGAGAAAAGAGG + Intronic
987721460 5:21638708-21638730 CTTTATCAGCAGCAGGAAAATGG - Intergenic
987929798 5:24389041-24389063 CTCTCTCTGATGGGGAAAAATGG + Intergenic
988012295 5:25505147-25505169 CTTTATCTGCAGTAAGAAAATGG - Intergenic
988605595 5:32676123-32676145 CTCTCTCTGATGGGGAAAAATGG - Intergenic
988900779 5:35729982-35730004 CTTTATCAGCTGCATGAAAACGG + Intronic
990367971 5:55089317-55089339 CTCTCTCTGATGGGGAAAAATGG - Intergenic
990757672 5:59093324-59093346 CTTTCTTTTTTGGAGGAAATCGG + Intronic
990922176 5:60979568-60979590 ACTTCTCTACTTGAGGAAAAGGG + Intronic
991304280 5:65160226-65160248 CTGACTGTGCTGGAGGAAAGGGG + Intronic
992049266 5:72928172-72928194 CTCTCTCTGATGGGGAAAAATGG + Intergenic
992084711 5:73267903-73267925 CTTTCTTTGGTGGGGGAGAAGGG - Intergenic
992090164 5:73309979-73310001 CTGTCTGTGCTGCTGGAAAAGGG + Intergenic
992455097 5:76909358-76909380 CTCTCTCTGATGGGGAAAAATGG + Intronic
992537430 5:77722373-77722395 CTTTCTTTTATAGAGGAAAAAGG + Intronic
993768848 5:91898894-91898916 CATTCTCTGGAGGAGTAAAATGG + Intergenic
993829333 5:92734274-92734296 TTTACTCTGCTGGAGGAATTAGG + Intergenic
994231840 5:97316405-97316427 CTCTCTCTGATGGTGAAAAATGG - Intergenic
994248813 5:97512867-97512889 TTTTCTTTGCTGGAGGAACGAGG - Intergenic
994341857 5:98639380-98639402 CTTTTTTTCCTGGAGGCAAAGGG + Intergenic
994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG + Intergenic
995023069 5:107388138-107388160 CCTCCTCTGCTGCAGGAAAAGGG + Intronic
995706335 5:114992246-114992268 CTCTCTGTGATGGGGGAAAATGG + Intergenic
995711593 5:115041440-115041462 CTTTCTTTTCTGGAGGACACTGG - Intergenic
995969208 5:117946993-117947015 ATGTCTCTGCTGGAGGAATAGGG + Intergenic
995981001 5:118104183-118104205 CTTTATATGCTGAAGGAAAAAGG + Intergenic
996099335 5:119430990-119431012 CTCTCTCTGGTGGGGAAAAATGG - Intergenic
996353167 5:122568108-122568130 CTTTCTCTGGTGGAAGAATTGGG - Intergenic
996488088 5:124059938-124059960 CTCTCTCTGCAGGAGCACAAAGG - Intergenic
996680278 5:126223161-126223183 CTCTCTCTGATGGGGAAAAATGG + Intergenic
996949643 5:129110310-129110332 CTTTCTCTCCTGGCTTAAAAAGG - Intronic
997103002 5:130989125-130989147 CTTTCTCTGGTAGAGAAAGAAGG + Intergenic
997468947 5:134105875-134105897 CTTACTCAGCTGGAGGGAACAGG + Intergenic
997891807 5:137683536-137683558 GTTTCTCTGCTCTAGGGAAAAGG + Intronic
997978737 5:138455698-138455720 GTTGCCCTGCTGGAGGAAAGAGG - Intergenic
998409736 5:141900558-141900580 ACTTCTCAGCTGGAGGAAACAGG - Intergenic
998558963 5:143153349-143153371 CTGTCTCTGGTGGAAGAAATGGG + Intronic
998757777 5:145399678-145399700 CTTTCTCGGCAGCATGAAAACGG - Intergenic
998914960 5:147003008-147003030 CTCTCTCTGATGGGGAAAAATGG + Intronic
999619752 5:153460646-153460668 CCTTCTTGGCTGGGGGAAAATGG + Intergenic
1001316914 5:170649772-170649794 ATTTCTCTGCTGCATTAAAAAGG - Intronic
1002110531 5:176907170-176907192 TTTTCTCTGTTACAGGAAAAAGG - Exonic
1002978255 6:2108584-2108606 CTTTCCTTGCTGGAGGGAACTGG - Intronic
1004496029 6:16163986-16164008 CTTTTTCTGTTGGATTAAAAAGG - Intergenic
1004812135 6:19273089-19273111 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1005856868 6:29869443-29869465 CTTTATCTCCTGTAGCAAAAGGG + Intergenic
1005858277 6:29880939-29880961 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1006038675 6:31235194-31235216 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1006221678 6:32496889-32496911 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1006481187 6:34295671-34295693 CTTTCTAGGCTGGAGTAAAAGGG - Exonic
1007077852 6:39079245-39079267 CTCTCTCTGCTAGAAGGAAAGGG - Intronic
1008358507 6:50586173-50586195 CTTTCTCTGCCGGAAGGAACAGG - Intergenic
1008587105 6:52960185-52960207 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1009872672 6:69470001-69470023 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1010205402 6:73318370-73318392 CTTTATCTGCAGCATGAAAATGG - Intergenic
1010269726 6:73905745-73905767 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1010920484 6:81674041-81674063 CTTTATCAGCAGGATGAAAATGG - Intronic
1011375155 6:86679524-86679546 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1011810809 6:91130189-91130211 CTTTCTCTGTTTGAGAAAATAGG + Intergenic
1012288454 6:97422134-97422156 TTCTCTCTGCTTGAGGAGAAGGG - Intergenic
1012380464 6:98614610-98614632 CTTTATCTGCAGCATGAAAATGG - Intergenic
1012394996 6:98786016-98786038 CCTCCTCCGCTGGAGGGAAAAGG - Intergenic
1012860225 6:104550822-104550844 ATTTCTATGCTGGAAGAAAGTGG - Intergenic
1013227255 6:108128974-108128996 CTTTATCAGCAGCAGGAAAATGG + Intronic
1013275570 6:108581609-108581631 CTTTCTATACTGGAAGGAAAAGG + Intronic
1013519268 6:110917615-110917637 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1013818982 6:114133225-114133247 CTGACTCTGAGGGAGGAAAACGG - Intronic
1013907960 6:115239289-115239311 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1014073877 6:117215097-117215119 ATTCCTCTGCTTGAGGAAAGTGG - Intergenic
1014448924 6:121561004-121561026 CTTTATCTGATGAAAGAAAATGG - Intergenic
1014500480 6:122183009-122183031 CTTTCTCTTCTGGAAGAAACGGG + Intergenic
1015855421 6:137619024-137619046 CTTGCTATGCTGTATGAAAATGG - Intergenic
1016183918 6:141178026-141178048 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1016495315 6:144654921-144654943 CTTTTTCTTCTTCAGGAAAATGG - Intronic
1016520849 6:144944901-144944923 CTTTATCTGCAGCATGAAAACGG + Intergenic
1018163786 6:161074820-161074842 CTTTCTAAGCGGGAAGAAAAGGG + Intronic
1018956502 6:168413642-168413664 CTTTATCTGCCTGAGGAGAACGG - Intergenic
1020260331 7:6527184-6527206 ATGGCTCTGCTGGAGGAAACTGG + Intronic
1020610289 7:10387959-10387981 CTTTCTCTGAGCTAGGAAAAAGG + Intergenic
1021356684 7:19659164-19659186 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1021357568 7:19671030-19671052 CTTTCTCTGCTAGAGCCACAAGG - Intergenic
1021613694 7:22481390-22481412 CTTTCTCTTCTGTAAGAAGAGGG - Intronic
1022893339 7:34723475-34723497 CTTTCTGTGCAGGAGGAAGGGGG + Intronic
1023078061 7:36502896-36502918 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1023151152 7:37202743-37202765 CTCTCTCTGATGGGGAAAAATGG - Intronic
1023364278 7:39447700-39447722 CTTTCCTTCCTGGAGGGAAAGGG - Intronic
1023576402 7:41632636-41632658 CTTCCTATGATGGGGGAAAAAGG - Intergenic
1023619872 7:42059854-42059876 CCTGCTCCACTGGAGGAAAAGGG - Intronic
1023880088 7:44313334-44313356 CTTTCTCTGAGGAAGGAAAAAGG + Intronic
1024102250 7:46044275-46044297 CTTTCTTTCCTGGAGGACACTGG - Intergenic
1024334587 7:48194496-48194518 CTTCCTGTGCTTCAGGAAAATGG + Intronic
1024735174 7:52296680-52296702 CTCTCTCTGATGGGGAAAAAGGG + Intergenic
1024910883 7:54445339-54445361 CTTTCTTTGTTGGATGAGAAAGG + Intergenic
1025102311 7:56145729-56145751 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1025273308 7:57547430-57547452 CTTTCTGGGCTGAAGGAAATAGG + Intergenic
1025552994 7:62272902-62272924 CTTTCTCTGCTGAAGGCTTAAGG + Intergenic
1026061757 7:67032858-67032880 ACTTCTCTGCTGCTGGAAAATGG - Intronic
1026266279 7:68798661-68798683 CTTGCTCTGCTGCAGGACCAGGG + Intergenic
1026487257 7:70832057-70832079 CTTTCTATGATGGAGTAATATGG + Intergenic
1026716588 7:72794573-72794595 ACTTCTCTGCTGCCGGAAAATGG + Intronic
1027516018 7:79142830-79142852 GCTTCTCTGCTGGTGGAACAGGG - Intronic
1027791011 7:82638953-82638975 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1028450532 7:90977251-90977273 CTTTCTGTGCAGCAGGCAAATGG - Intronic
1028495332 7:91454462-91454484 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1028671929 7:93410875-93410897 TTTTCTCTGCTGGAGTCTAAAGG + Intergenic
1028868049 7:95736367-95736389 ACTCCTCTGCTTGAGGAAAAGGG - Intergenic
1029007172 7:97222841-97222863 CTTTCTATACAGGAGGAAAATGG - Intergenic
1029292453 7:99512570-99512592 CCTCGTCTCCTGGAGGAAAATGG + Exonic
1031721989 7:125187730-125187752 CTTCTTCTGCTTGAGGAAAGGGG + Intergenic
1031731665 7:125309687-125309709 CTTTCTCTGATGGGGAAAAATGG + Intergenic
1033509590 7:142041810-142041832 CTTCCTCTGCTGGAAGATTAAGG - Intronic
1033512438 7:142072408-142072430 CTTCCTCTGCTGGAAGATTAGGG - Intronic
1034234714 7:149557707-149557729 CTGTCTTTACTGCAGGAAAAAGG + Intergenic
1034580088 7:152034418-152034440 CTCTCTCTGATGGGGAAAAATGG - Intronic
1034942881 7:155243300-155243322 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1035655500 8:1302048-1302070 CTGTGTGTGCTGGGGGAAAAGGG + Intergenic
1036893901 8:12615313-12615335 CTTTATCAGCTGTATGAAAATGG - Intergenic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1038392366 8:27214434-27214456 CTTTCCCTGCTGGAAGCAAGAGG - Intergenic
1038577792 8:28720206-28720228 CTCTCTCTGCTATAGAAAAAGGG + Intronic
1038638673 8:29306842-29306864 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1038856402 8:31337759-31337781 CTTACTCTGCAAGAGAAAAAGGG + Intergenic
1039691694 8:39871263-39871285 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1039756011 8:40523694-40523716 GTTTCTCTACTGGGGGAACATGG + Intergenic
1039999792 8:42566287-42566309 CTCTCTCTGGTGGGGAAAAATGG - Intergenic
1040318797 8:46278910-46278932 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1040667985 8:49655141-49655163 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1040796913 8:51297413-51297435 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1040953268 8:52956504-52956526 CTCTCTCTGATGGGGAAAAAAGG + Intergenic
1040965170 8:53075233-53075255 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1040971576 8:53141691-53141713 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1041000046 8:53440997-53441019 CTCTCTCTGATGGTGAAAAATGG - Intergenic
1041156730 8:54995157-54995179 CTTTCTTTTCTAGAGGATAATGG + Intergenic
1041338981 8:56822024-56822046 CTTTCTCAGCAGCATGAAAATGG + Intergenic
1041369549 8:57144010-57144032 CTTTCTTTGCTGAATAAAAATGG - Intergenic
1041467361 8:58170162-58170184 CTTCCCCAGCTGCAGGAAAATGG - Intronic
1041774151 8:61505614-61505636 CTTTATCAGCTGCATGAAAACGG + Intronic
1041791040 8:61696440-61696462 CATTCTCTGCTGCAGTAAATCGG - Intronic
1042771793 8:72389815-72389837 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1043024105 8:75044930-75044952 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1043982144 8:86655499-86655521 TTTTTTCTTGTGGAGGAAAAAGG + Intronic
1044073079 8:87786063-87786085 CTTTATCAGCTGCATGAAAAAGG - Intergenic
1044442376 8:92237413-92237435 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1044456739 8:92399028-92399050 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1044922923 8:97185086-97185108 CTTTCTCTCCTGGCTGAAAGTGG - Intergenic
1047654569 8:126962996-126963018 CATACTTTGCTGGAGGAAAGGGG - Intergenic
1048423408 8:134299614-134299636 CTTTGTCTACTGGAGTAAAGGGG - Intergenic
1049795220 8:144494055-144494077 CTTTCTCTTCTGTAGGACATGGG + Intronic
1050330403 9:4540093-4540115 CTTTCTCTGCTGTTGGAGACTGG - Intronic
1050535896 9:6630580-6630602 CTTTCTCTGCTAGAGGGTAAGGG + Intronic
1050572469 9:6955461-6955483 CCTTCTCTGCTCTTGGAAAAGGG - Intronic
1050599386 9:7235166-7235188 CTTTCTGAGCTAAAGGAAAAAGG + Intergenic
1051681323 9:19610935-19610957 CCTGCTCTGTTGGAGGAATAAGG + Intronic
1051935154 9:22436404-22436426 CTGTCTCTGATGGGGAAAAATGG + Intergenic
1052071115 9:24082124-24082146 CTTTATCTGCAGCATGAAAATGG + Intergenic
1052267282 9:26589595-26589617 CTTTCTCAGCAGCATGAAAATGG - Intergenic
1055148577 9:72966425-72966447 CTTGCTCTGCTGGAGTACAGTGG + Intronic
1055537040 9:77258899-77258921 ATTTCTCTGAGGGAAGAAAAGGG + Intronic
1055950053 9:81722084-81722106 CTTGGTCTCCTGGAGGAGAAAGG + Intergenic
1056291915 9:85152065-85152087 CTTTCTCTGCTGGAGTTCTATGG + Intergenic
1056392907 9:86155412-86155434 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1057286009 9:93754922-93754944 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1057355743 9:94329563-94329585 TTTTCTTTCCTGGAGGAAATAGG + Intergenic
1057576923 9:96250093-96250115 CATTCTCAGCTGGAGGAAGAGGG + Intronic
1057652015 9:96928063-96928085 TTTTCTTTCCTGGAGGAAATAGG - Intronic
1058136255 9:101310552-101310574 CTGCCTCTGCGGGAAGAAAACGG + Intronic
1058274733 9:103025200-103025222 CTTTATCAGCTGGGTGAAAACGG + Intergenic
1058401428 9:104624410-104624432 CTTTATCAGCAGGGGGAAAACGG + Intergenic
1060326414 9:122620531-122620553 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1060409971 9:123393907-123393929 CTTGCTTTGCCGGAGGACAATGG + Intronic
1060489237 9:124070005-124070027 TTTTCTATGCTGCAGGCAAATGG + Intergenic
1060539701 9:124421105-124421127 CTTTCCCTGCAAGAGGAAGATGG - Intergenic
1060912904 9:127364740-127364762 CTTTATCTGTTGGAGGCAGAAGG + Intronic
1060944491 9:127561917-127561939 ACTTCTGTGCTGGAGGAAGAAGG - Intronic
1061780753 9:132994844-132994866 CTTTCTCTGCTGTATGCAAATGG - Intergenic
1061875295 9:133540511-133540533 CTGTCTCAGAGGGAGGAAAAGGG + Intronic
1203687245 Un_GL000214v1:6677-6699 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1203755391 Un_GL000218v1:121081-121103 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1203714762 Un_KI270742v1:133621-133643 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1203536443 Un_KI270743v1:44470-44492 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1203649030 Un_KI270751v1:97376-97398 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1188136404 X:26499331-26499353 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1188167922 X:26885496-26885518 CTTTCTCTACTGGGGAAGAACGG - Intergenic
1188744099 X:33820496-33820518 CTTTCACTCATGGAGGAAGAAGG - Intergenic
1188759303 X:34005901-34005923 CTTTTCCTCCTGGAGGAAACAGG + Intergenic
1188849703 X:35116491-35116513 CTTTCTCTGTTGCAGAGAAAGGG - Intergenic
1189003428 X:36969725-36969747 CTTGCTCTGCTTTAGGTAAATGG + Intergenic
1190541336 X:51481489-51481511 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1191185127 X:57603304-57603326 CTTTCTCTGCAGCAGGAGAGGGG + Intergenic
1191206055 X:57835142-57835164 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1192482886 X:71500331-71500353 CTCTCTCTGATGGGGAAAAATGG - Intronic
1192687686 X:73324247-73324269 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1193314063 X:80043521-80043543 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1193666313 X:84322652-84322674 ATTTCTCTGCTTGAGTAATAAGG + Intronic
1194000296 X:88420352-88420374 CTTTATCTGCAGCATGAAAATGG + Intergenic
1194455535 X:94098682-94098704 CTTTCTCTGAGGGAAGAGAAGGG + Intergenic
1194856464 X:98935324-98935346 CATTCTCAGCTGTAGAAAAAAGG - Intergenic
1195439450 X:104884615-104884637 CTCTCTCTGATGGGGAAAAATGG + Intronic
1196170634 X:112584539-112584561 CTTTTTCAGCTGCATGAAAATGG - Intergenic
1196420681 X:115517575-115517597 TTATCTCTACTGGGGGAAAACGG - Intergenic
1196488868 X:116245363-116245385 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1196542238 X:116923451-116923473 CTTTATCTGCAGGAGCATAATGG + Intergenic
1197023305 X:121717057-121717079 CTTTCTCAGCAGCATGAAAATGG - Intergenic
1197145299 X:123165758-123165780 CTTTCCCTGCCAGAGGCAAAAGG + Intergenic
1197513288 X:127396884-127396906 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1197895709 X:131312133-131312155 CTTTCTCTGATAGAGGAACTTGG - Intronic
1199832533 X:151560353-151560375 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1200089208 X:153626488-153626510 CTGCCTCTGCTTGAGGAAAGGGG - Intergenic
1200711158 Y:6486143-6486165 CTCTCTCTGGTGGGGAAAAATGG + Intergenic
1200801134 Y:7388004-7388026 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1200880915 Y:8210526-8210548 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1200966662 Y:9045182-9045204 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1200970791 Y:9150436-9150458 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1200978466 Y:9238923-9238945 CTTTCTTTTCTGGAGGACACTGG + Intergenic
1201022777 Y:9675843-9675865 CTCTCTCTGGTGGGGAAAAATGG - Intergenic
1201169008 Y:11238690-11238712 CTTTCTTTTCTGGAGGACACTGG - Intergenic
1201332787 Y:12845427-12845449 CATTTTCTGATAGAGGAAAAAGG + Intronic
1201530446 Y:14985323-14985345 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1201568691 Y:15391962-15391984 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1201649005 Y:16265040-16265062 CTCTCTCTGATGGGGAAAAATGG - Intergenic
1201653804 Y:16320260-16320282 CTCTCTCTGATGGGGAAAAATGG + Intergenic
1202140240 Y:21713877-21713899 CTTTCTTTTCTGGAGGACACTGG + Intergenic