ID: 956268503

View in Genome Browser
Species Human (GRCh38)
Location 3:67425028-67425050
Sequence CTGGCTAAAGGTGTGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956268503 Original CRISPR CTGGCTAAAGGTGTGGGGGA AGG (reversed) Intronic
900184256 1:1325573-1325595 CGGGCTTCAGGTGTGGGGGATGG - Intronic
900299077 1:1967782-1967804 TTCCCTAAAGGTGTGGGGTAGGG - Intronic
900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG + Intergenic
900494419 1:2969998-2970020 CTGGCTGAGGGTGTCAGGGAGGG + Intergenic
901491069 1:9596591-9596613 CTGGCTAGAGGTGTGTGGGTGGG + Intronic
901507084 1:9691586-9691608 CGGGCCAAGTGTGTGGGGGAAGG + Intronic
902227156 1:15003672-15003694 TTGGGAAAAGGGGTGGGGGACGG + Intronic
902555139 1:17242495-17242517 CTGGCTGAAGGTGGCGGGGAGGG + Intronic
903005430 1:20295086-20295108 CTAGATAAAGGGGTGGGGAAAGG + Intronic
903239748 1:21974847-21974869 CTGGCGTAAGGTCTGGGGAATGG + Intergenic
903435158 1:23343985-23344007 CGGGCTAAAGGGGCGGGGGGAGG + Intronic
903749802 1:25614575-25614597 GGGGCTAGAGGTGTGGGGCAAGG + Intergenic
904326751 1:29731495-29731517 CTGCCTATAGGTGTGAGGGATGG + Intergenic
904605047 1:31693412-31693434 TTGGGTACGGGTGTGGGGGATGG - Intronic
904625461 1:31799656-31799678 CTCCCCAAAGGGGTGGGGGAAGG - Intronic
904699675 1:32351160-32351182 CTAGCTAGAGGCGTGGGGGAGGG - Intergenic
905179485 1:36157086-36157108 CCGGATAAAGGCGAGGGGGAGGG + Intronic
905774541 1:40660149-40660171 CTGGTTATAGGGGTGTGGGACGG + Intronic
905916824 1:41690307-41690329 CTGGCTCAAGGGGCAGGGGATGG + Intronic
906795776 1:48695553-48695575 CTGGTTAAAGGGGAGGGGGTGGG - Intronic
906880278 1:49582272-49582294 CTGGTAAAATGTTTGGGGGAGGG + Intronic
906940671 1:50252524-50252546 CTGGATAATGGGGAGGGGGAAGG + Intergenic
907115015 1:51960530-51960552 TTGGGCAACGGTGTGGGGGAAGG + Intronic
908117662 1:60956097-60956119 CTGGCTGAAGCTGTGTAGGAAGG + Intronic
908413286 1:63887564-63887586 CTGGGTAGAGGTGTGGGAGTAGG - Intronic
911176471 1:94822576-94822598 CTGGACAAAGGCTTGGGGGAAGG + Intronic
911369310 1:96977396-96977418 CTTGCTTAGGGTTTGGGGGAGGG + Intergenic
912468532 1:109890738-109890760 CAGGCTCCAGGAGTGGGGGAAGG - Intergenic
912947508 1:114097175-114097197 CTGGCTAAAGCTGTGGAGCTGGG - Intronic
914737612 1:150432971-150432993 CTGTCTCAAGGTGAGGGGGTTGG + Intronic
915025793 1:152828211-152828233 ATGGCTAAAGATATGGAGGAGGG + Intergenic
916346509 1:163797769-163797791 CTGGCAGGAGGTGTGGGGGGTGG - Intergenic
917506220 1:175629494-175629516 CTGTATAGAGATGTGGGGGAGGG + Intronic
918043200 1:180925746-180925768 GTGGCTGGAGGGGTGGGGGAAGG + Intronic
918501986 1:185207398-185207420 CTGGCTAAAGTTGGGGTTGAGGG - Intronic
919881517 1:201904151-201904173 CTGGCTAGGGGTGAGAGGGAAGG - Intronic
919991755 1:202712165-202712187 CTGGCTAAGGGTGGGGGTGGTGG - Intergenic
920366621 1:205451288-205451310 CTGGTGGTAGGTGTGGGGGATGG - Intronic
920678446 1:208054954-208054976 CTCCCTAAAGGAGTGGGTGAGGG + Intronic
920915689 1:210256269-210256291 GTGGCTTACGGTGTAGGGGAGGG - Intergenic
921786479 1:219236902-219236924 CTGTCAAGGGGTGTGGGGGAGGG - Intergenic
922336983 1:224625696-224625718 GTGGTTGAAGGTGTGGAGGAGGG + Intronic
923485793 1:234429753-234429775 CTTTCTAAAGGTGGGGGGGGGGG + Intronic
923757254 1:236802987-236803009 CTGGCAATAGGTGAGGGAGAAGG + Intronic
924397427 1:243637120-243637142 CTGAATAAAGGTATGGGGGTGGG + Intronic
1062871432 10:908316-908338 GTGGGGCAAGGTGTGGGGGAAGG - Intronic
1065811947 10:29450637-29450659 CTGGCTGGAGGTGGGAGGGAGGG - Intergenic
1065959832 10:30725520-30725542 CTGGCTGGAGGTGGGAGGGAGGG + Intergenic
1066967919 10:42286715-42286737 TTGGCTACAGGTCAGGGGGATGG - Intergenic
1067429613 10:46234422-46234444 CTGGCTCAAGGGGTGGGGCCAGG + Intergenic
1068100140 10:52542393-52542415 CTGGATAAAGATTTGGGGAATGG + Intergenic
1068819166 10:61353125-61353147 CTGGATAAAAGTGGGGAGGAAGG - Intergenic
1069686065 10:70319566-70319588 CTGGTCACAGGTGTAGGGGAGGG - Intronic
1069882435 10:71602146-71602168 CCGGCTCAAGGTGTGTGTGATGG + Intronic
1070150769 10:73803528-73803550 CAGGCTAAAGGTTGGGGGGAGGG - Intronic
1070567243 10:77613251-77613273 CTGGGGAAGGTTGTGGGGGAAGG - Intronic
1070790882 10:79188638-79188660 CTGGGTAAAAGACTGGGGGAGGG - Intronic
1071309275 10:84328153-84328175 CTTGCTAAAGCTGAGGGGAAGGG - Intergenic
1071563506 10:86660087-86660109 GAGGCTGAAGGTGTGGGGGCAGG + Intronic
1072097651 10:92198155-92198177 CTGGCTCAAGGTTATGGGGATGG + Intronic
1073429224 10:103475611-103475633 CTGGCCAATGGTGCGGTGGAGGG - Intronic
1073488022 10:103834010-103834032 CTGGTTAGAGACGTGGGGGAGGG - Intronic
1074082026 10:110175708-110175730 CTGGCCAAAGGAGGGGGGCAAGG + Intergenic
1074611391 10:115025442-115025464 CTGGCTGCAGGGGTGGGGGTTGG - Intergenic
1075188226 10:120282562-120282584 TTGGCTCCAGGTGTGGGGGTGGG - Intergenic
1075716793 10:124560476-124560498 TTAGCTAAAGCTGTGGGAGAAGG + Intronic
1075730191 10:124631302-124631324 GAGGCTGAAGGAGTGGGGGAAGG + Intronic
1077721663 11:4636512-4636534 CTGGATAACAGGGTGGGGGATGG - Intergenic
1078004619 11:7523218-7523240 CTGGGCAAAGGTGTGTGGAAGGG - Intronic
1078462066 11:11521784-11521806 CTGGCCAAAGGTGTGTGGGCTGG - Intronic
1078637630 11:13066543-13066565 ATGGGTAAAGGAGTGGGGGTGGG + Intergenic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1084431442 11:69113673-69113695 CTGAGTGAAGGTGTGGGGAAAGG - Intergenic
1084876508 11:72137438-72137460 CTGGCCCAGGTTGTGGGGGAGGG - Intronic
1084881525 11:72174814-72174836 CTGGCCCAGGTTGTGGGGGAGGG - Intergenic
1087440153 11:98173629-98173651 ATGCCTATAGTTGTGGGGGATGG - Intergenic
1088537669 11:110878736-110878758 CTGGCTAAAGATGTGGGATATGG - Intergenic
1090809305 11:130222628-130222650 CTGGCTGGAGGGGTGAGGGAAGG - Intergenic
1091455635 12:605350-605372 CTGGGGATAGGTGTTGGGGAAGG - Intronic
1091593999 12:1863134-1863156 CTGAATAAATGTATGGGGGAGGG - Intronic
1093311756 12:17596533-17596555 CAGGGTAAAGGTTTGGAGGAGGG + Intergenic
1096459977 12:51816857-51816879 CTGGATAAAGCTGCTGGGGATGG - Intergenic
1097053367 12:56236737-56236759 CTGGCCATAGGTGTGAGGGGTGG + Exonic
1097244953 12:57602658-57602680 CTGGAAAAAGGGGTGGGAGAAGG - Exonic
1101202858 12:102455000-102455022 TTGGCTGGAAGTGTGGGGGAAGG + Intronic
1103612699 12:122133742-122133764 CTGGCTAAAGGTGGTGGCGGGGG - Exonic
1103917906 12:124385432-124385454 CTGTCTCACGGTGTGGGGGAAGG - Intronic
1106555799 13:30807470-30807492 CTGGCTAGAGGAGTGGGGCTGGG + Intergenic
1107147601 13:37075385-37075407 CTGGATACAGCTGTGGGAGATGG - Intergenic
1107418539 13:40223695-40223717 CTGGCTAATGATCTGGAGGAGGG - Intergenic
1108473148 13:50787709-50787731 ATTGTTAAAGGTGGGGGGGAGGG - Intronic
1108662494 13:52599878-52599900 CTGGCTAAAGCTGGGGCGGTAGG + Intergenic
1109387879 13:61656457-61656479 AAGGCTAAGGGTGTGTGGGAGGG - Intergenic
1111934612 13:94546528-94546550 CTGGCTATTGGTGTGGGTGGGGG - Intergenic
1112667815 13:101596907-101596929 TTGGGGAAAGGTGTGGGAGAGGG + Intronic
1113966246 13:114155388-114155410 CAGGGTAGAGGTGTGGGGCATGG + Intergenic
1116947794 14:50852453-50852475 CAGGATGAAGGTGTAGGGGAGGG - Intergenic
1118302658 14:64629033-64629055 CTGGAGACAGGGGTGGGGGAGGG + Intergenic
1119883084 14:78116936-78116958 TTGGCTGAAGGTGGGTGGGAAGG + Intergenic
1120751154 14:88199473-88199495 CTGGCTAGAGCTGTCTGGGAAGG + Intronic
1120941823 14:89956515-89956537 CTTGCTGAAGGCGTTGGGGACGG - Intronic
1121637765 14:95465407-95465429 CTGGATAAACGAGTGGGTGATGG + Intronic
1126779079 15:52123321-52123343 CTGGATGCAGGGGTGGGGGAGGG - Intronic
1128325711 15:66722755-66722777 CTGGGTAGAGGTGTGAGGGGGGG + Intronic
1129355935 15:74991806-74991828 GTGGCTAAAGGGGTATGGGAAGG - Intronic
1129827044 15:78640998-78641020 CTGGCCACAGGTGGGAGGGAAGG - Intronic
1130225795 15:82057567-82057589 AATGCTCAAGGTGTGGGGGATGG + Intergenic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1132668305 16:1091731-1091753 CTGTCTGAATGTGTGGGGGCTGG - Intronic
1132784230 16:1645933-1645955 TTGGGGCAAGGTGTGGGGGAGGG - Intronic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1134131635 16:11654329-11654351 ATGGCCAAAGGTGTGGGCCATGG + Intergenic
1135949347 16:26898732-26898754 CTGGGTGATGGTGTTGGGGAAGG - Intergenic
1136176396 16:28519982-28520004 CTGGGTCAAGGTGTGGGAGGTGG - Intergenic
1136383462 16:29908121-29908143 TTGACCAAAGGAGTGGGGGAGGG + Intronic
1136734013 16:32446232-32446254 TTGGCTACAGGTCAGGGGGATGG - Intergenic
1137267415 16:46880667-46880689 CTGGACCAGGGTGTGGGGGATGG - Intergenic
1137921700 16:52495434-52495456 CAGGCCTAAAGTGTGGGGGAAGG + Intronic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1141042167 16:80681975-80681997 GTGGCCAAATGTGTGGGGGGTGG - Intronic
1141984829 16:87572898-87572920 CTGGCTGAAGGTCAGGGGGCAGG - Intergenic
1203019069 16_KI270728v1_random:383367-383389 TTGGCTACAGGTCAGGGGGATGG + Intergenic
1203037404 16_KI270728v1_random:656525-656547 TTGGCTACAGGTCAGGGGGATGG + Intergenic
1142892558 17:2953995-2954017 CTTGCTTAAGCTGAGGGGGATGG - Intronic
1143978203 17:10845807-10845829 CTGGCTAATTTTGTGGGGGCGGG - Intergenic
1145851052 17:28097019-28097041 CTGGCTAGAGGTGGTGGTGATGG - Intronic
1147939327 17:44034802-44034824 CTGGCTAGAGCTTTGGGGGTGGG - Exonic
1148245984 17:46031137-46031159 CTGCCCACAGGTGTGAGGGAGGG + Exonic
1148965414 17:51430964-51430986 CTGGATAAGGGTGTATGGGATGG - Intergenic
1149340677 17:55682945-55682967 TAGGCTGAAGGTGTAGGGGAGGG + Intergenic
1149553194 17:57555178-57555200 CTGGCTAGATGTGTGGGAGATGG - Intronic
1149856011 17:60083524-60083546 TTGGTTAAAGGTGAGGAGGAGGG - Intergenic
1151576163 17:74953534-74953556 CCGGCTAAGGGGGTGGGTGACGG - Exonic
1155399314 18:25420475-25420497 CTGGATAAAGATGCTGGGGAAGG + Intergenic
1156106515 18:33669280-33669302 CAGGCTAAAGGTGAGAAGGATGG + Intronic
1158723913 18:59950892-59950914 CTAGGTAAAGGTGGGAGGGAAGG + Intergenic
1160395967 18:78572468-78572490 ATGGTTACAGGTGAGGGGGACGG + Intergenic
1160395983 18:78572534-78572556 ATGGTTACAGGTGAGGGGGACGG + Intergenic
1160395999 18:78572600-78572622 ATGGTTACAGGTGAGGGGGACGG + Intergenic
1160980665 19:1815277-1815299 CTGCCTGGAGGTGAGGGGGAAGG + Exonic
1160991185 19:1860951-1860973 CAGGCTCAAGGGGTGGGGGAGGG + Intronic
1161083207 19:2321695-2321717 CTGGATGAAGGGGTTGGGGATGG + Exonic
1161470395 19:4454178-4454200 CTGGCTGATGGTGCTGGGGAGGG - Intronic
1161640748 19:5421179-5421201 CTGGCTGGAGGGGTGGGGGACGG + Intergenic
1163607781 19:18284823-18284845 CTGGCTACAGGTCTGCGGGCTGG - Intergenic
1166566274 19:43767451-43767473 GTGGCTAAGGGGGCGGGGGATGG - Intronic
1167038194 19:47006671-47006693 CAGGCTAGAGGTTTGGGGAAGGG - Intergenic
1168146143 19:54420897-54420919 CTGGCAAAGGATGCGGGGGAAGG + Intronic
925673190 2:6333626-6333648 CTCTATAAAGGTGTTGGGGAAGG - Intergenic
926217798 2:10915886-10915908 CTGGAGAAACGTGTGAGGGAGGG - Intergenic
926744378 2:16138900-16138922 TTGGGTGAAAGTGTGGGGGATGG - Intergenic
927483903 2:23475738-23475760 CATGCTAAATGTGTGGGGGAAGG + Intronic
928387944 2:30885464-30885486 ATGGCGAAAGGTGGGGTGGAGGG + Intergenic
929188009 2:39115034-39115056 CTGGCATAAGAAGTGGGGGAAGG - Intronic
929236791 2:39613764-39613786 CTTGCTAGAGGTTTGGGGTAGGG - Intergenic
929457967 2:42079471-42079493 CTGGCAAGAGCTGTGGGGGAAGG + Intergenic
930424830 2:51199454-51199476 CTGGCCAAAGGTTTGTTGGATGG + Intergenic
931475988 2:62588010-62588032 CTGGGTATAGGTGTGCAGGATGG - Intergenic
931874733 2:66499486-66499508 CTGTAAGAAGGTGTGGGGGAAGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934311731 2:91873193-91873215 TTGGCTACAGGTCAGGGGGATGG + Intergenic
934574777 2:95392944-95392966 CTGGGGAAAGGGGTGAGGGATGG + Intergenic
935454387 2:103250206-103250228 CTGGCAAAAGGAGAGGGAGAAGG - Intergenic
935952981 2:108347919-108347941 CCCGCTAAAGGTGTGGAGAAAGG + Intergenic
936881146 2:117252392-117252414 CTGTCTAAGGGTTTGGGGCAAGG - Intergenic
937355280 2:121194630-121194652 CTGGTTTATGGTGTGAGGGATGG - Intergenic
938278152 2:130046013-130046035 GGGGCTAGAGGAGTGGGGGAGGG - Intergenic
938437226 2:131291372-131291394 GGGGCTAGAGGAGTGGGGGAGGG + Intronic
942267398 2:174242219-174242241 CGGACCAAGGGTGTGGGGGATGG + Intronic
942877879 2:180824404-180824426 TGGGGGAAAGGTGTGGGGGAAGG - Intergenic
944476309 2:200110376-200110398 CTGGCAGAAGGTTTGGTGGATGG - Intergenic
944537483 2:200725458-200725480 CTGTCAAAGGGTGAGGGGGAGGG - Intergenic
944540380 2:200748630-200748652 CTGGCACAGGGTTTGGGGGATGG - Intergenic
946614320 2:221493313-221493335 CTGGCTAAGGGATTTGGGGAGGG - Intronic
947817827 2:233049717-233049739 CTTGCTGGAGGTGTGGGAGAGGG - Intergenic
1168873779 20:1155223-1155245 CTGGCTAAAGGAGCAGGGAAAGG + Intronic
1168928014 20:1598805-1598827 CTGACTGTAAGTGTGGGGGATGG - Intronic
1170225718 20:13990246-13990268 CTTGGGAAGGGTGTGGGGGATGG - Intronic
1170375924 20:15699945-15699967 TCGAGTAAAGGTGTGGGGGAGGG - Intronic
1170818900 20:19739444-19739466 CTGGCCACGGGTTTGGGGGATGG + Intergenic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172852484 20:37976734-37976756 CTGGGCGTAGGTGTGGGGGAGGG - Intergenic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1173519785 20:43690568-43690590 CTGGGCAAAGGTGTAGGGTAAGG - Intronic
1174810292 20:53639720-53639742 TTGGTTAAAGGAGTTGGGGAAGG - Intergenic
1176065062 20:63190198-63190220 CTGGGTACAGGTGTGCAGGAGGG - Intergenic
1176175541 20:63721689-63721711 CTACCTGAAGTTGTGGGGGAGGG - Intronic
1178123141 21:29489811-29489833 CTGGCTAGGGGTCTGGGGTAGGG + Intronic
1178356370 21:31913282-31913304 CTGGCCAAGAGTGTGTGGGAGGG + Intronic
1179622889 21:42630439-42630461 GTGGCCACAGGTGTGGTGGAGGG + Intergenic
1179790574 21:43753836-43753858 CTGGCCCCAGTTGTGGGGGAGGG + Intronic
1180538480 22:16419010-16419032 TTGGCTACAGGTCAGGGGGATGG + Intergenic
1182609263 22:31532909-31532931 GTGGTTTAAGGTGTGGGGAAAGG + Intronic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184687396 22:46102793-46102815 CTGGCTGTGGCTGTGGGGGAAGG + Intronic
1184850182 22:47115404-47115426 GTGGCTAAAGGGGCGGGGCAGGG - Intronic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
949313127 3:2722478-2722500 GTGGCTAGAGGTGTATGGGAAGG + Intronic
953836581 3:46351370-46351392 CTGGCAGAAGGTGTGGAGGGGGG + Intergenic
955094395 3:55782758-55782780 CTGGCTGAATGTGGGGGAGAGGG - Intronic
956260423 3:67333871-67333893 GTGGCTGGAGGTGTGGGGAAGGG + Intergenic
956268503 3:67425028-67425050 CTGGCTAAAGGTGTGGGGGAAGG - Intronic
957453096 3:80404961-80404983 CTGGCTCAATGAGTAGGGGAAGG + Intergenic
958896852 3:99839038-99839060 CAAGGTAAAGGTGTGGGGGCAGG - Intronic
961016705 3:123473982-123474004 CTGGCTGAAGGTGGAGGGCAGGG + Intergenic
961813244 3:129533757-129533779 CTGGGGGAAGGTGTAGGGGATGG - Exonic
962315290 3:134355529-134355551 GTGGGAAAAGGAGTGGGGGAAGG + Intergenic
962595893 3:136943029-136943051 CTGACTTGGGGTGTGGGGGATGG + Intronic
962848638 3:139291228-139291250 CTGGCTTAGGGAGTGAGGGAGGG - Intronic
963975719 3:151478089-151478111 CTGCCTGAGGGTGTGGGGGCAGG - Intergenic
966811276 3:183847134-183847156 TTGGCTAAAAGTATGGGTGAAGG + Intronic
967729418 3:192893724-192893746 CTCTTTAAAGATGTGGGGGACGG - Intronic
967860632 3:194148773-194148795 CTGGGTAGAGATGCGGGGGAGGG - Intergenic
969614472 4:8244362-8244384 CTTGCTGAATGTGTGTGGGAAGG - Intergenic
971036700 4:22701188-22701210 CTGTCACAAGGTGTGGGGGAAGG - Intergenic
972281022 4:37602335-37602357 GTGGCTAAAGCTGTGGGCTAGGG - Intronic
973646115 4:52952820-52952842 CTGGGAAAAGGTGGGGGAGAAGG - Intronic
973772516 4:54219694-54219716 CTGGCCTAAGCTCTGGGGGATGG + Intronic
973867436 4:55127485-55127507 TTGGATAAAGGGGTGGGAGATGG + Intergenic
974573553 4:63687694-63687716 GGAGATAAAGGTGTGGGGGATGG - Intergenic
975365194 4:73520901-73520923 CTTGCTTAGGCTGTGGGGGATGG + Intergenic
975696744 4:77021380-77021402 CTGGGTAAAGTTGTGGGGTGAGG + Intronic
976613719 4:87054901-87054923 CTGGCTAAAAGTGTGGGGGGCGG - Intronic
976841120 4:89433338-89433360 GTGGCTAAAGGTCTGGGGGAAGG + Intergenic
979090565 4:116477925-116477947 CTGGCTCAGTGTGTGGGGGTAGG + Intergenic
979185099 4:117779120-117779142 ATGGCCAAAGTTGTAGGGGATGG + Intergenic
981603677 4:146520822-146520844 TTGTCTAAAGGTGTTGGGGGGGG + Intronic
982213050 4:153056478-153056500 GTGGCTATAGGAGTGGGGGTGGG + Intergenic
982254660 4:153440282-153440304 CTGAATAAATGAGTGGGGGATGG + Intergenic
982617586 4:157659679-157659701 CTGTCTGGGGGTGTGGGGGAAGG + Intergenic
984676658 4:182556647-182556669 CTGGCTACAGGGGAGTGGGAAGG - Intronic
985655941 5:1131364-1131386 CTGCTGAAGGGTGTGGGGGAGGG + Intergenic
986305111 5:6508785-6508807 ATGGCCATGGGTGTGGGGGAGGG + Intergenic
986664326 5:10087142-10087164 CTGGCGAGAGGTGCGGGTGAGGG - Intergenic
991339855 5:65596791-65596813 CTGGCTGAGGGTGTGGGGTGGGG - Intronic
994326893 5:98458426-98458448 CTGGCTGAAGTTCTGGGGTATGG - Intergenic
995172459 5:109132703-109132725 CTGGGTAGAGGTTTGGAGGATGG + Intronic
996053336 5:118957175-118957197 CTGGCTTTAGGAGTGGAGGAAGG + Intronic
996522036 5:124438100-124438122 CTGGCACACGGGGTGGGGGAGGG + Intergenic
997529270 5:134572084-134572106 GTGCTTAAGGGTGTGGGGGAAGG + Intronic
998468906 5:142367755-142367777 TTGGCTAAAGGTGGGAGGGAAGG + Intergenic
999789496 5:154925950-154925972 TTGGCCATAGGTGTTGGGGATGG - Exonic
999928521 5:156405790-156405812 CTGGCTATAGGCCTGGGGGCAGG + Intronic
1000163693 5:158626509-158626531 CTGGCTGAACGGGTGAGGGAAGG - Intergenic
1000513275 5:162209424-162209446 CTGGCGAGGGGTGTGGGGCAGGG - Intergenic
1001073518 5:168606858-168606880 CTGGCTAAAACAGTGCGGGAAGG + Intergenic
1001750484 5:174126645-174126667 CTGGCCAATGGAGTGTGGGAGGG + Intronic
1001769552 5:174282872-174282894 CTGGCTCTAGCTCTGGGGGATGG + Intergenic
1002056939 5:176603550-176603572 CTGGCTTATGAGGTGGGGGAGGG + Intronic
1003631689 6:7793353-7793375 GTGGCCAAGGGTTTGGGGGAAGG + Intronic
1005018460 6:21395417-21395439 CTGGCCAAAAATGTGGGGAATGG - Intergenic
1007079338 6:39087629-39087651 CTGGGGAAAGGTTTTGGGGAGGG - Exonic
1009432922 6:63586477-63586499 CTGGCAAAAGTAGTGGGGAAAGG + Intergenic
1012953314 6:105541657-105541679 CTAGAGAAAGGTATGGGGGAAGG - Intergenic
1013420105 6:109959728-109959750 CTGGATAAAGGAGTGCAGGATGG - Intergenic
1013675881 6:112462065-112462087 CTGCCAAAAAGTGGGGGGGAGGG - Intergenic
1017023958 6:150165436-150165458 CTGGCTAAAGTCCTTGGGGAAGG + Intronic
1018448180 6:163877851-163877873 CTAGCTACAGGGGTGGGGGAAGG - Intergenic
1018730992 6:166650373-166650395 CTGTCTAGAGGTGGGAGGGAGGG + Intronic
1019031596 6:169018440-169018462 CTGGCTAAAATGGTGGGGGCAGG + Intergenic
1019463094 7:1171853-1171875 CTGGCTAGAGGTGGGGGGGGGGG - Intergenic
1019676609 7:2317166-2317188 CAGGCTAAAAGTGTGGGGTTTGG + Intronic
1023885435 7:44350495-44350517 CTGGCCAAAGGACTGGGGAAAGG + Intergenic
1026799816 7:73392889-73392911 CTGGCTAATTTTGTGGGGGGTGG + Intergenic
1027476925 7:78643727-78643749 ATGGCACAAGGGGTGGGGGATGG + Intronic
1027631243 7:80608911-80608933 CTGGCTATGGGGGTGGGGGTGGG - Intronic
1030043222 7:105470748-105470770 CTGTCAAAAGGTGTGTGGAAGGG - Exonic
1031864238 7:127020389-127020411 CTGGTTCAAGGTGAGGGAGATGG - Intronic
1033277722 7:139985301-139985323 CAGGCTAGAGGGGTGGGGGGTGG - Intronic
1033300758 7:140182998-140183020 CTGGCTAAAGTTGTGGTAGGAGG + Intergenic
1034292786 7:149945928-149945950 CTGGGAACAGGTGTGGAGGAGGG + Intergenic
1034685354 7:152966331-152966353 CTGGCTAACGGTCTGGGGGTTGG + Intergenic
1035130725 7:156650742-156650764 TTGGCTCAAGGTGTGGGAGCAGG - Intronic
1037677797 8:21066861-21066883 CTGGCTAAGGGCCTGGGGGCAGG - Intergenic
1037784009 8:21891813-21891835 CTGGCTCTGGGTGTGGGAGATGG - Intergenic
1038609713 8:29049125-29049147 GTGGCTGATGGGGTGGGGGAGGG + Intronic
1039237950 8:35523765-35523787 CTGGCTAGAGCTTTGGGGGTGGG - Intronic
1039358569 8:36848868-36848890 CTGTATATATGTGTGGGGGAGGG + Intronic
1041192996 8:55372335-55372357 CTGGCTAAAGGTCAGGTGAATGG - Intronic
1043945892 8:86252425-86252447 GTGGCTAAAGGGGTGTGAGAGGG - Intronic
1043993923 8:86789636-86789658 CTGGGTAAAAGTATGGGAGAGGG + Intergenic
1044368469 8:91378544-91378566 CTTGCTAAAGGTCTGGGAAAAGG + Intronic
1044498334 8:92918776-92918798 CTGGCAAAAATTGTGGGGGGGGG - Intronic
1044629400 8:94263910-94263932 GTGGCTACAGATGTGGGGAAAGG + Intergenic
1044864416 8:96556309-96556331 CTGGTTAAAAGTGTGTGGGGCGG - Intronic
1044979453 8:97700984-97701006 CTGGCTAAAGGTTAGGGGGCTGG + Intronic
1046669067 8:117037507-117037529 CTGGCTTAAGCGGTGGGTGAGGG - Intronic
1047324259 8:123821226-123821248 CAGGCCAAAGGTGAGGTGGAGGG - Intergenic
1047456379 8:125016993-125017015 CTGCCTGGAGCTGTGGGGGACGG + Intronic
1047732353 8:127737650-127737672 CTGGCAAAAGGAGTGTTGGACGG + Intronic
1049200781 8:141339612-141339634 CAGGCTCAAGGCCTGGGGGAAGG - Intergenic
1049570275 8:143367051-143367073 CTGGCGAAGGGGGTGGGTGAAGG + Intergenic
1050096999 9:2077196-2077218 CTGGCTAAAGCTGGGAGGGCAGG - Intronic
1050318072 9:4423448-4423470 TTTTCTAAAGGTCTGGGGGAGGG - Intergenic
1053404430 9:37859850-37859872 CGGGGTGAAGGTGTGGGGAAAGG - Intronic
1057050018 9:91916469-91916491 GTGGGTAAAGGTGAGGGGCAGGG - Intronic
1057339684 9:94188825-94188847 CTGGATCAAGGTGTGGTGGATGG - Intergenic
1057357115 9:94340871-94340893 AGGGCCAAAGGTGTGGGGCAAGG - Intergenic
1057650637 9:96916756-96916778 AGGGCCAAAGGTGTGGGGCAAGG + Intronic
1060054284 9:120400553-120400575 ATGGCTACAGGAGTGTGGGACGG + Intronic
1060196661 9:121628458-121628480 CTGGCTATGGGTGTGGTGGTTGG + Intronic
1060290753 9:122300265-122300287 GTGGATCAAGGTGTGGGGGCTGG + Intronic
1061012345 9:127963106-127963128 CTGACCAAAGGTGGGGTGGAAGG + Intronic
1061202650 9:129146549-129146571 GTGGCCAAAGGTGTGGGAGGAGG + Intronic
1061313062 9:129776786-129776808 CTGGCTCCAGGGGTGGGGGTGGG - Intergenic
1061429507 9:130522457-130522479 CAGGGTCAGGGTGTGGGGGAGGG - Intergenic
1061492627 9:130954490-130954512 CTGGCTAAGGGTGTGGTGGTGGG - Intergenic
1061700433 9:132411099-132411121 GAGGCTAAAGGTGGGGAGGAGGG - Intronic
1062546918 9:137067990-137068012 GTGGGTACAGGTGTGGAGGAAGG + Intronic
1186349796 X:8730583-8730605 CTGGGTCAAGGGGTGGGGGGGGG - Intronic
1186796347 X:13050316-13050338 CTGACTCAAGGTGTGGGGGAGGG + Intergenic
1187915785 X:24150616-24150638 GTGGCTACAGGCGCGGGGGAAGG - Intronic
1187995765 X:24924790-24924812 TTGGGTAAGGGTGTGGAGGAAGG + Intronic
1189391120 X:40577700-40577722 CTATGGAAAGGTGTGGGGGAGGG - Intergenic
1189650631 X:43185185-43185207 TTGGCTAAAGGAGTGAAGGAGGG - Intergenic
1190214754 X:48472555-48472577 ATGGCTAAAGGTCGGGGGGTGGG + Intergenic
1192069712 X:67923813-67923835 CTGTCTAGGGGTGTGGGGCAAGG + Intergenic
1192436458 X:71146269-71146291 CTGGCTGAAGGGGTGGGGGAGGG - Intronic
1195318097 X:103698324-103698346 CTGTATATATGTGTGGGGGATGG + Intergenic
1196978151 X:121182621-121182643 CTGTCTAAAGGTGGGGGAAACGG - Intergenic
1198019741 X:132646210-132646232 CTGGCCAACTGTGTTGGGGAGGG - Intronic
1198343180 X:135734449-135734471 CTTGCTCAAGGTGTGAAGGAAGG - Intergenic
1198344809 X:135748846-135748868 CTTGCTCAAGGTGTGAAGGAAGG + Intergenic
1199932728 X:152540734-152540756 CTGCCTCAGAGTGTGGGGGAAGG - Intergenic
1200282143 X:154786062-154786084 CTGGCATAATGGGTGGGGGAGGG - Intronic
1200686517 Y:6264309-6264331 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200989387 Y:9335225-9335247 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200992062 Y:9355558-9355580 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200994715 Y:9375836-9375858 CTGGCCAAATGTCTGGGAGATGG - Intronic
1200997378 Y:9396182-9396204 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200999892 Y:9464719-9464741 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1201002551 Y:9485028-9485050 CTGGCCAAATGTCTGGGAGATGG - Intronic
1201005208 Y:9505313-9505335 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1201007869 Y:9525642-9525664 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1201010485 Y:9545832-9545854 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1201073155 Y:10168535-10168557 CTGGCTGAGGGTGGGGAGGAGGG + Intergenic