ID: 956269876

View in Genome Browser
Species Human (GRCh38)
Location 3:67440205-67440227
Sequence TAGTTTTTGCATAAAGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21352
Summary {0: 1, 1: 12, 2: 765, 3: 9878, 4: 10696}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956269876 Original CRISPR TAGTTTTTGCATAAAGTGTA AGG (reversed) Intronic
Too many off-targets to display for this crispr