ID: 956277568

View in Genome Browser
Species Human (GRCh38)
Location 3:67519405-67519427
Sequence GTGTAACATTAGAAGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956277567_956277568 -8 Left 956277567 3:67519390-67519412 CCTATTTATTTTAATGTGTAACA 0: 1
1: 0
2: 7
3: 47
4: 561
Right 956277568 3:67519405-67519427 GTGTAACATTAGAAGTGTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956277568 Original CRISPR GTGTAACATTAGAAGTGTGC TGG Intronic
905360451 1:37415839-37415861 GTGTAACTGTACATGTGTGCTGG - Intergenic
907107673 1:51898955-51898977 GTTTAATATTAGAAGTGTTTTGG - Intergenic
909467449 1:75988833-75988855 GTTTAATATTAGAAGTGTTTTGG + Intergenic
913502146 1:119481185-119481207 GTTTAACTGCAGAAGTGTGCAGG - Intergenic
915431081 1:155867579-155867601 GTGTAACAGTTGAAGTGAACAGG + Intronic
917510924 1:175668691-175668713 GTGTAATATTAGCATGGTGCCGG - Intronic
918494262 1:185115757-185115779 GTTTAATATTAGAAGTGTTTGGG + Intergenic
918584560 1:186170795-186170817 GTGTAACAAAAACAGTGTGCAGG - Intronic
918874298 1:190019698-190019720 GTCTAATATTAGAAGTGTTTTGG - Intergenic
921488623 1:215746648-215746670 GTTTAATATTAGAAGTGTTTTGG + Intronic
922043602 1:221921661-221921683 GTTTAATATTAGAAGTGTTTTGG - Intergenic
923167426 1:231379433-231379455 GTTTACCATTAGAAGTGTTTTGG - Intronic
1065979147 10:30874020-30874042 GTGTGACATGAGAAGTTTGCTGG - Intronic
1066195175 10:33092162-33092184 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1066453793 10:35554885-35554907 GAATAACATTAGAGGTGTGGAGG + Intronic
1067939683 10:50643774-50643796 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1068683804 10:59848272-59848294 GTGTAACATTTAAAGTGTTTGGG + Intronic
1069057981 10:63864795-63864817 GTGTAACATAAAAAGTGAGGGGG + Intergenic
1069434146 10:68365645-68365667 ATTTAATATTAGAAGTGTTCTGG + Intronic
1071661506 10:87506763-87506785 GTGAAAAATTAGAAGTAGGCTGG + Intronic
1073835594 10:107437514-107437536 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1074083693 10:110190037-110190059 GTGTTACATTTGAAGTGAGGTGG + Intergenic
1077657099 11:4029818-4029840 GTGTAATATTAGGAGTGTTTTGG + Intronic
1078583721 11:12561483-12561505 GTTTAATATTAGAAGTGTTTGGG - Intergenic
1081390342 11:42522038-42522060 GTTTAACATTACAACTGTGTAGG - Intergenic
1081953422 11:47066881-47066903 GTTTAATATTAGAGGTGTGTAGG + Intronic
1088289142 11:108217366-108217388 GTTTAATATTAGAAGTGTTTTGG + Intronic
1088427274 11:109717829-109717851 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1088913554 11:114210105-114210127 GTGAAACATTGCAAATGTGCGGG + Intronic
1089615737 11:119693706-119693728 GTCCAACATTAGAGGTGTGTTGG - Intronic
1094681353 12:32670052-32670074 GGGGAACATTAGATGGGTGCAGG + Intergenic
1095658269 12:44697148-44697170 GTTTAATATTAGAAGTGTTTTGG - Intronic
1098863581 12:75736766-75736788 GTGTAATATTAGAAGTGTTTGGG - Intergenic
1101093988 12:101317109-101317131 GTATAGCATTAGGACTGTGCTGG - Intronic
1101614294 12:106321015-106321037 GTTTAATATTAGAAGTGTTTGGG + Intronic
1111606243 13:90543274-90543296 ATGTAAAATTAGATGAGTGCTGG + Intergenic
1111728292 13:92040766-92040788 GTTTAACATTTGAAGTGTTTGGG + Intronic
1112006114 13:95255212-95255234 GTGTTACACGAGAAGTGTGCTGG - Intronic
1113726614 13:112607898-112607920 GCATAATATTAAAAGTGTGCAGG + Intergenic
1116739561 14:48736811-48736833 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1117404587 14:55389646-55389668 ATGTAACATTAAATGAGTGCCGG - Intronic
1117414829 14:55485193-55485215 GTCCAACATTAGAAGTGTTTTGG + Intergenic
1119231073 14:72980287-72980309 CTGTAAAAGGAGAAGTGTGCAGG + Intronic
1121386512 14:93531961-93531983 TTGTAAAAGTAGCAGTGTGCAGG + Intronic
1123982660 15:25618191-25618213 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1128008554 15:64269140-64269162 GTTTAACATTACAAGTGTTTTGG + Intronic
1131561151 15:93441195-93441217 ATTTAACATTAGAAGTGTTTTGG + Intergenic
1135300882 16:21326077-21326099 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1138921885 16:61540595-61540617 GTGTAACACTCGAAGTGTCATGG - Intergenic
1141291268 16:82720049-82720071 GTTTAATATTAGAAGTGTTTTGG - Intronic
1147246741 17:39126479-39126501 GTTTAATATTAGAAGTGTTTTGG - Intronic
1148187913 17:45657844-45657866 CAGTAACTTTAGATGTGTGCAGG + Intergenic
1149692183 17:58587095-58587117 GTTTAATATTAGAAGTGTCTTGG + Intronic
1151343747 17:73488549-73488571 GTGTAACATTTGCAGTGAGCTGG - Intronic
1153396619 18:4628873-4628895 GTTTAAAATTAGAAGTGTTTTGG + Intergenic
1153440149 18:5108150-5108172 GTCTACCAATAGAAGTGTCCAGG - Intergenic
1155125978 18:22876052-22876074 GTTTAATATTAGAAGTGTTTTGG + Intronic
1155591396 18:27431360-27431382 GTTTAATATTAGAAGTGTTTGGG - Intergenic
1158134432 18:54190594-54190616 GTTTATCATTAGAAGTGTTTTGG + Intronic
1158382091 18:56942586-56942608 GTTTAACATTGGAAGTGTTTTGG + Intronic
1158969951 18:62657070-62657092 GTTTAATATTAGAAGTGTTTGGG + Intergenic
1159667919 18:71185985-71186007 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1159795540 18:72838531-72838553 GGATGACAGTAGAAGTGTGCAGG - Intronic
1160028170 18:75236125-75236147 GTGTAACATTTGTGGGGTGCTGG + Intronic
1161684765 19:5697304-5697326 GTGTGACACTTTAAGTGTGCAGG + Intronic
1163362338 19:16854888-16854910 GTTTAATATTAGAAGTGTTTTGG + Intronic
1168049695 19:53819990-53820012 GTGTGCCAGTAGTAGTGTGCTGG - Intronic
925657271 2:6163576-6163598 ATGTAACATTATAAGTGTGTAGG - Intergenic
926005773 2:9372577-9372599 GTTTAATATTAGAAGTGTTCTGG - Intronic
929797336 2:45070281-45070303 GTGAAACATTAGACGGCTGCAGG - Intergenic
929802525 2:45116527-45116549 ATGTAACATTTGATATGTGCAGG - Intergenic
931065530 2:58581833-58581855 GTTTAATATTAGAAGTGTTTTGG + Intergenic
931895450 2:66724071-66724093 GTTTAACATTAGAAGTGTTTTGG + Intergenic
931956296 2:67429348-67429370 GTTTAATATTAGAAGTGTTTTGG + Intergenic
932682984 2:73842564-73842586 GTTTAATATTAGAAGTGTTTTGG + Intronic
933151641 2:78922344-78922366 TTTTAACATTAGAAATGTGTTGG + Intergenic
935424389 2:102904842-102904864 GTTTAATATTAGAAGTGTTTTGG - Intergenic
938183825 2:129209823-129209845 ATGTAACATTAAAAATGTCCTGG + Intergenic
938585903 2:132690454-132690476 GTTTAATATTAGAAGTGTTCTGG + Intronic
938762819 2:134440943-134440965 GTTTAATATTAGAAGTGTTTTGG + Intronic
938978596 2:136504135-136504157 GTTTAATATTAGAAGTGTTTTGG + Intergenic
939364361 2:141213249-141213271 GTTTAACATTAGAAGTGTTTTGG - Intronic
939532448 2:143381580-143381602 CTGTAAAAATGGAAGTGTGCAGG - Intronic
939737936 2:145872737-145872759 GTCTAATATTAGAAGTGGGGAGG + Intergenic
941978730 2:171432934-171432956 GTTTAATATTAGAAGTGTTTTGG - Intronic
942318057 2:174712409-174712431 GTTTAATATTAGAAGTGTTTTGG + Intergenic
947411438 2:229844948-229844970 GTGTAATAGTAGAAATGTGTTGG - Intronic
1169490093 20:6064110-6064132 ATTTAACATTAGAAGTGTTTTGG - Intergenic
1169590997 20:7142190-7142212 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1170738541 20:19032161-19032183 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1174558846 20:51415611-51415633 ATGTATCTTTAGAGGTGTGCTGG - Intronic
1174844000 20:53925927-53925949 GTGTAAAATTAAGATTGTGCCGG + Intergenic
1176423075 21:6531904-6531926 GTTTAATATTAGAAGTGTTTGGG - Intergenic
1176907642 21:14522696-14522718 GTTTACCATTAGAAGTGTTTGGG - Intronic
1176985504 21:15431364-15431386 GAGTAACATGGGAAGTGTGTTGG - Intergenic
1177171513 21:17660971-17660993 GTGTAAAATAAGAAGTGTGGGGG + Intergenic
1177941104 21:27412170-27412192 ATGTAAGAGTAGAAGAGTGCCGG - Intergenic
1179298321 21:40082906-40082928 GAGTGACATCAGTAGTGTGCTGG - Intronic
1179698569 21:43140220-43140242 GTTTAATATTAGAAGTGTTTGGG - Intergenic
1184191801 22:42899933-42899955 CTGTAACATTAGAAATGGGGAGG + Intronic
1185164625 22:49253792-49253814 GACTAACATCAGAAATGTGCTGG + Intergenic
950605989 3:14080639-14080661 TTGTAACAATAGCAGAGTGCTGG - Intronic
952892868 3:38055157-38055179 ATGAAACATAAGAAGTGTGGAGG + Intronic
953649591 3:44789886-44789908 GTTTAATATTAGAAGTGTGTTGG - Intronic
956277568 3:67519405-67519427 GTGTAACATTAGAAGTGTGCTGG + Intronic
956888571 3:73586364-73586386 GTCTAACATTAGAAGTATTCAGG - Intronic
958707923 3:97679365-97679387 GAGTAGCATTTGAAGTGTGTGGG + Intronic
959504291 3:107140931-107140953 CTGGAGCATTAGAAGTGTGTGGG + Intergenic
960478725 3:118162320-118162342 GTCTAATATTAGAAGTGTTTTGG + Intergenic
962074235 3:132063945-132063967 TTGTAACAAGAGAAGTGTTCTGG + Intronic
963579861 3:147111793-147111815 GTTTAATATTAGAAGTGTTTTGG - Intergenic
964384569 3:156133660-156133682 GTGTGATATTAGAAGTGTGAAGG + Intronic
966008780 3:175050501-175050523 GTTTAATATTAGAAGTGTTTTGG + Intronic
966166630 3:177026418-177026440 GTGGAATATTTGAAGTTTGCTGG - Exonic
967607066 3:191459104-191459126 GTTTAATATTAGAAGTGTTTTGG + Intergenic
968753542 4:2402753-2402775 GTGTATCATTAGATGTGGGTGGG - Intronic
969258073 4:6016143-6016165 GTTTAACATTAGAAGTGTTTGGG + Intergenic
970676563 4:18456936-18456958 GTTTAATATTAGAAGTGTTTGGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972249041 4:37280220-37280242 GTTTAATATTAGAAGTGTTTTGG - Intronic
973652752 4:53012988-53013010 ATGTAACAGTGGAAGTGTGGTGG - Intronic
974290578 4:59924687-59924709 ATGTAAAATTAAAAGAGTGCTGG - Intergenic
974394153 4:61313694-61313716 GTTTAACATTAGAAGTATTTGGG - Intronic
974993336 4:69121796-69121818 ATGTAAAATTAGATGAGTGCTGG - Intronic
975073657 4:70177421-70177443 GTTTAATATTAGAAGTGTTTTGG + Intergenic
975252432 4:72195681-72195703 GTTTAACATTAGAAGTGTTTAGG + Intergenic
975544509 4:75547587-75547609 GTTTAATATTAGAAGTGTTTTGG - Intronic
976114471 4:81712162-81712184 GTTTAATATTAGAAGTGTTTTGG + Intronic
976441086 4:85075628-85075650 GTTTAACAGTAGAAGTGTTTGGG - Intergenic
977972134 4:103224743-103224765 GTGTAAGATTAGAGGTGCGTTGG + Intergenic
978713479 4:111813746-111813768 GTGTAACAGTGGTAGTGTGTGGG - Intergenic
981384356 4:144110682-144110704 GTCTAACAGTAGAACTGTGTCGG - Exonic
983252426 4:165359983-165360005 GTTTAATATTAGAAGTGTTTGGG - Intergenic
983966799 4:173822737-173822759 CTGTACAATTAGAAGTCTGCTGG - Intergenic
984651334 4:182273792-182273814 GTGTAAATTGAGAAGTGTGAAGG + Intronic
984784479 4:183554696-183554718 GTGTAACATGAGAAGTGTTTTGG + Intergenic
987342044 5:16947895-16947917 GTTTAAAATTAGTAGTATGCTGG + Intergenic
989492644 5:42076288-42076310 GTTTAACATTAGAAGTGTTTTGG - Intergenic
989798692 5:45507929-45507951 ATATAACATTATATGTGTGCAGG + Intronic
990107874 5:52287010-52287032 GTTTAATATTAGAAGTGTTTTGG - Intergenic
990956142 5:61341399-61341421 GTTTAATATTAGAAGTGTTGTGG + Intronic
991219433 5:64195665-64195687 GTTTAATATTAGAAGTGTTTTGG - Intronic
991230224 5:64324142-64324164 GTTTAATATTAGAAGTGTTTTGG - Intronic
992709781 5:79440244-79440266 GTGTAACATTCTAAATGTGAAGG - Intronic
992850987 5:80807354-80807376 GTTTAATATTAGAAGTGTGTTGG - Intronic
993729909 5:91410193-91410215 GTTTAATATTAGAAGTGTCTTGG - Intergenic
994911750 5:105918748-105918770 GTGGAACTTTAGAAGTATCCAGG - Intergenic
995048546 5:107675139-107675161 GTTTAACATTAGAAGTGTTTTGG - Intergenic
995930154 5:117431760-117431782 GTTTAAGATTAGAAGTGTTTTGG + Intergenic
997053758 5:130414942-130414964 ATGTGACATTAGAATTGTGTTGG - Intergenic
1000044970 5:157514851-157514873 GTGTAACAATGGCAGTGTACAGG - Intronic
1001207868 5:169780913-169780935 GTATAATATTAGAAGTGTTTTGG - Intronic
1004160270 6:13206559-13206581 GTTTAATATTAGAAGTGTTGTGG - Intronic
1004813869 6:19291283-19291305 GTTTAATATTAGAAGTGTTTGGG - Intergenic
1004902423 6:20206531-20206553 ATGTAATATTAGGAGTGTGGGGG - Intronic
1005086267 6:22010072-22010094 GTTTAACATTAGAAGTGCTTTGG - Intergenic
1005103556 6:22199417-22199439 GTGTCACATGAGAAGGGTGAGGG - Intergenic
1005189515 6:23204187-23204209 GTTTAATATTAGAAGTGTTCTGG - Intergenic
1005320057 6:24644378-24644400 GTTTAATATTAGAAGTGTTGTGG + Intronic
1006977173 6:38113997-38114019 GTGTTAGAGTAGAGGTGTGCTGG + Intronic
1007799907 6:44383601-44383623 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1008720872 6:54350075-54350097 TTGTAACATTAGCAGTGTAAAGG + Intronic
1008843323 6:55931180-55931202 ATGTAAAATAAGAAGTGTGAAGG - Intergenic
1008922314 6:56855340-56855362 GTTTAATATTAGAAGTGTTTTGG - Intronic
1008950746 6:57156170-57156192 GTGTAACATTAAAAATGTAGTGG - Intronic
1011952919 6:92990052-92990074 TTGAAACATTAGAAGACTGCAGG - Intergenic
1012248326 6:96952282-96952304 GTTTAATATTAGAAGTGTTTTGG + Intronic
1012379212 6:98600117-98600139 GTGTAAGATTAGAAGTAAGCTGG + Intergenic
1014195946 6:118558307-118558329 GTTTAATATTAGAAGTGTTTGGG + Intronic
1015995461 6:138991770-138991792 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1016278648 6:142386383-142386405 GTTTAATATTAGAAGTGTTTCGG - Intronic
1017032122 6:150233447-150233469 GTTTAATATTAGAAGTGTTTGGG - Intronic
1017102960 6:150864988-150865010 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1018498073 6:164370519-164370541 ATGTAAAATTAGATGAGTGCTGG + Intergenic
1019980540 7:4618479-4618501 GAATAAAATTAGAAGTGTTCGGG - Intergenic
1020250682 7:6465987-6466009 GTGCCAGATTAGAAGAGTGCTGG + Intronic
1021136630 7:16972359-16972381 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1028163262 7:87509515-87509537 GTGCTACATTCAAAGTGTGCTGG - Intronic
1030152038 7:106417225-106417247 CTCTAACATTAGAAGTGCGTTGG + Intergenic
1030463059 7:109864634-109864656 GTGTAACAGTAAAAATATGCTGG + Intergenic
1030592157 7:111494870-111494892 ATGTAAAATGAGAAATGTGCAGG - Intronic
1033910240 7:146254535-146254557 GTGTCCTATTAGAAGTGTTCAGG + Intronic
1037684616 8:21128360-21128382 GTTTAATATTAGAGGTGTTCGGG + Intergenic
1041082760 8:54228973-54228995 GTATAACATGAGAGCTGTGCTGG + Intergenic
1041164321 8:55075657-55075679 GTTTAATATTAGAAGTGTTCTGG + Intergenic
1041627330 8:60045339-60045361 CTGTAGCATCAAAAGTGTGCTGG + Intergenic
1042900605 8:73722894-73722916 GTTTAATATTAGAAGTGTTTTGG - Intronic
1043705149 8:83339828-83339850 GTATAAAATTAGAATTTTGCTGG + Intergenic
1043910256 8:85855724-85855746 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1045130722 8:99149096-99149118 GTGTAACATTATCAGGATGCTGG + Intronic
1045192863 8:99900094-99900116 GTTTAATATTAGAAGTGTTTTGG + Intergenic
1049130534 8:140836128-140836150 GTTTAATATTAGAAGTGTTTTGG + Intronic
1049874945 8:145011145-145011167 GTGGAAGATTACAATTGTGCTGG - Intergenic
1049962637 9:751276-751298 GTGTAACTTCAAAAGTGTGTGGG - Intergenic
1053597824 9:39581437-39581459 TTGCATCATTAGAAGAGTGCTGG + Intergenic
1053855845 9:42338441-42338463 TTGCATCATTAGAAGAGTGCTGG + Intergenic
1055363271 9:75518339-75518361 GTTTAAGATTAGAAGTGTTTTGG - Intergenic
1056445329 9:86660447-86660469 CTGTTACATTTCAAGTGTGCAGG - Intergenic
1057108173 9:92441041-92441063 GTTTAATATTAGAAGTGTTTTGG - Intronic
1057987760 9:99734513-99734535 GAGAAAGATTAGAATTGTGCTGG + Intergenic
1058247914 9:102653980-102654002 GTTTAATATTAGAAGTGTTTTGG - Intergenic
1058527088 9:105869926-105869948 GTTTAACATTAGAAGTGTTCTGG + Intergenic
1186498143 X:10028800-10028822 GTTTAATATTAGAAGTGTTTAGG + Intronic
1188390862 X:29617399-29617421 GTGCAATATGAGAAATGTGCAGG + Intronic
1188526017 X:31088629-31088651 GTTTAATATTAGAAGTGTCTTGG + Intergenic
1190553132 X:51605657-51605679 CTGTCACATTATAAGGGTGCTGG + Intergenic
1193449794 X:81651673-81651695 GTAAAACTTTAAAAGTGTGCAGG + Intergenic
1195454632 X:105053784-105053806 GTTTAACATTATAAGTGTTTTGG - Intronic
1195770556 X:108346734-108346756 GTTTAATATTAGAAGTGTTTTGG - Intronic
1195961736 X:110394211-110394233 GTTTAATATTAGAAGTGTTTGGG + Intronic
1196272352 X:113727315-113727337 GGCTAACATGAGAAGAGTGCAGG + Intergenic
1200368271 X:155691591-155691613 GTGTAAAATTAAAAGAGTGCTGG + Intergenic
1200849489 Y:7868289-7868311 GAGTAACATTATATGGGTGCTGG + Intergenic
1200858380 Y:7963590-7963612 GTGTAACATGACTCGTGTGCTGG + Intergenic
1200859275 Y:7973022-7973044 GAGTAACATTATCTGTGTGCTGG + Intergenic
1200897092 Y:8387301-8387323 GAGTCACATTAAATGTGTGCTGG + Intergenic