ID: 956279905

View in Genome Browser
Species Human (GRCh38)
Location 3:67545256-67545278
Sequence GTTGCCATAAAAAGGAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956279902_956279905 20 Left 956279902 3:67545213-67545235 CCAAATGCTAGAGATACAGAATT 0: 1
1: 0
2: 3
3: 25
4: 252
Right 956279905 3:67545256-67545278 GTTGCCATAAAAAGGAATCCAGG 0: 1
1: 0
2: 1
3: 17
4: 160
956279903_956279905 -3 Left 956279903 3:67545236-67545258 CCAGACAACAGCTTGATGTTGTT 0: 1
1: 0
2: 4
3: 26
4: 244
Right 956279905 3:67545256-67545278 GTTGCCATAAAAAGGAATCCAGG 0: 1
1: 0
2: 1
3: 17
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956279905 Original CRISPR GTTGCCATAAAAAGGAATCC AGG Intronic
904785493 1:32979541-32979563 TATGCCTTAAAAAGAAATCCAGG + Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
908500899 1:64743590-64743612 TTAGCCATAAAAAGGAATTAAGG - Intergenic
911880371 1:103230350-103230372 GTTGTCATAAAAAGAACACCCGG + Intergenic
917509536 1:175658814-175658836 GTTTCCAGAAAATGGGATCCAGG - Intronic
917670474 1:177269113-177269135 GTTACCATCAAAAGGAAATCCGG - Intronic
918267119 1:182853863-182853885 GATGCAATAAAAAGTAATTCTGG + Intronic
922299906 1:224289522-224289544 TTTGCCATCTAAAGGAGTCCAGG - Exonic
923412167 1:233721448-233721470 GCTGCCATATAAGGGCATCCTGG - Intergenic
923738246 1:236632240-236632262 GTTGCCGTGAAAAGGAGTTCAGG + Intergenic
1063139782 10:3245677-3245699 GTTGCCATGAACAGGAGTCCAGG + Intergenic
1063282610 10:4647099-4647121 GATTCCAAAAAAAGGAATCAAGG - Intergenic
1064450641 10:15439309-15439331 TTGGCCATAAAATGAAATCCAGG - Intergenic
1067444266 10:46330818-46330840 GTAGCCAAAAAATGGAAACCAGG - Intergenic
1070228876 10:74542289-74542311 GTTTCCAGGAAAAGGAATCCAGG - Intronic
1072503288 10:96040655-96040677 GCTGCCATTAAAAGGAATCCTGG + Intergenic
1073523592 10:104157873-104157895 ATTGCCAGCAAAAGGAATCCAGG + Intronic
1075690466 10:124390502-124390524 GTTGTGATAAAAAGGAAGGCAGG + Intergenic
1075841384 10:125507525-125507547 TTTCCCAGAAAAAGGAAGCCGGG + Intergenic
1077957273 11:7034434-7034456 TTTGCCAATAAAAGGAATCAGGG - Intronic
1078672015 11:13374078-13374100 GTTGCCCTAAAAGGGAATAAAGG - Exonic
1082086502 11:48054670-48054692 TTTTTCATAAAAGGGAATCCCGG - Intronic
1084245285 11:67852790-67852812 GTGGCCATCAGAAGGAAGCCTGG - Intergenic
1084827403 11:71741788-71741810 GTGGCCATCAGAAGGAAGCCTGG + Intergenic
1087896109 11:103588401-103588423 GTTGCATGAAAGAGGAATCCAGG + Intergenic
1088981094 11:114864619-114864641 GTTGGCATAAGAAAGACTCCAGG - Intergenic
1089932703 11:122330075-122330097 TTTGTCATAAAAAGCATTCCAGG + Intergenic
1092415853 12:8289922-8289944 GTGGCCATCAGAAGGAAGCCTGG - Intergenic
1094095850 12:26703701-26703723 GTTTACAGAAAAAGAAATCCAGG - Intronic
1099367993 12:81793303-81793325 GTTTCCAGAAAAATGAATACTGG - Intergenic
1100055542 12:90504522-90504544 GTTGCCATCAAATGGAACCCAGG + Intergenic
1101127694 12:101654444-101654466 ATTGCCATAAAAGAGTATCCAGG + Intronic
1101419701 12:104540329-104540351 GGAGCCATAAAAAAGAATACAGG + Intronic
1103579219 12:121901980-121902002 TTGGCCATAAAAAGGAATGAAGG - Intronic
1106533251 13:30615288-30615310 GTTGCCAAAAATATGAATACAGG + Intronic
1108472506 13:50781616-50781638 GGAGCCATAAAAAGGGCTCCAGG - Intronic
1109511674 13:63384367-63384389 GTTGCCATTAATAAGAATCATGG - Intergenic
1110102456 13:71626559-71626581 GTTGCCACTAAAAAGAATCCAGG + Intronic
1111297581 13:86302618-86302640 GGTGGCATAAAAAGGAATGCTGG - Intergenic
1112527574 13:100166597-100166619 GCAGCAATAAAAAGGAATGCAGG - Intronic
1114520467 14:23331145-23331167 TCAGCCATAAAAAGGAATACTGG - Intergenic
1118032602 14:61833161-61833183 GTTACTATAAAAAGTGATCCAGG - Intergenic
1121071065 14:91021870-91021892 TTTCCCATTAAAAGGAATCAAGG - Intronic
1122391440 14:101389597-101389619 GTTGGACTAAAAAGGAATCATGG - Intergenic
1128698030 15:69783209-69783231 GTTCACAGAAAAAGGAATACAGG - Intergenic
1131242496 15:90758909-90758931 GTTACCATTAAAGGGAAGCCTGG + Intronic
1131623114 15:94088485-94088507 TTGGTCATATAAAGGAATCCTGG + Intergenic
1132412622 15:101595171-101595193 GTTGCCAAAAAAAAAAGTCCAGG - Intergenic
1133362112 16:5182447-5182469 TTGGCCATAAAAAGGAATGAAGG + Intergenic
1134101238 16:11453032-11453054 GCTGCCGTAAAAAGGATCCCAGG - Intronic
1136090763 16:27918306-27918328 GTTACCAGAAAAAGGGATGCTGG + Intronic
1144541528 17:16147108-16147130 TTTATCATAAAAAGAAATCCAGG + Intronic
1146763921 17:35501760-35501782 GTGGCCATCAGAAGGAAGCCTGG + Intronic
1148249754 17:46066156-46066178 TTTGCCCTAAAAAAGAATCTTGG - Intronic
1151158569 17:72145257-72145279 ATTGCCATAAAATGGAATTCAGG - Intergenic
1151910907 17:77082680-77082702 GTTGCTATAAAAAGGATTTAAGG + Intergenic
1152528471 17:80903078-80903100 GTTACCATAGAAATGGATCCAGG + Intronic
1155914267 18:31540598-31540620 TTTGACATAAAAACGAATCTAGG + Intronic
1156095555 18:33527208-33527230 GCAGTCATAAAAAGGAATGCAGG - Intergenic
1159643755 18:70893150-70893172 TTTGCCATTAAAAGTAATGCTGG + Intergenic
1163400646 19:17090449-17090471 TTGGCCATAAAAAGGAATGAAGG - Intronic
1163401824 19:17098589-17098611 GTTGCAAGAAAAAGAAATGCTGG - Intronic
1163405629 19:17120343-17120365 TTAGCCATAAAAAGGAATGAAGG + Intronic
1164913721 19:32032865-32032887 GTGGCTATAAAGAGGAATCTAGG - Intergenic
1166323278 19:42033017-42033039 TCAGCCATAAAAAGGAATGCAGG + Intronic
925587603 2:5479090-5479112 GTTGCTCTCAAAAGGAATCCTGG + Intergenic
926630825 2:15134926-15134948 TTTGCCATAAAAAGCAAACCTGG - Intergenic
926902879 2:17775263-17775285 GTTGAAATAAAAAGCAATCAAGG + Intronic
929007113 2:37406613-37406635 GTTGCCAGAGACAGGATTCCGGG - Intergenic
930852635 2:55976796-55976818 GTTGCATTAAAAAGAAATACAGG - Intergenic
931740178 2:65235454-65235476 TCTGCCTTAAAAAGTAATCCAGG + Intronic
932651516 2:73563416-73563438 GTTGCCTTAAAAAAGAATGAAGG + Intronic
934675485 2:96246805-96246827 GTTACCTTAAAAAGGAGTCTAGG + Intergenic
935942172 2:108251580-108251602 TTTCCCATAAACTGGAATCCAGG - Intronic
941868368 2:170357760-170357782 GTTACCATAACCAGCAATCCAGG + Intronic
942321435 2:174739990-174740012 TTAGCCTTAAGAAGGAATCCTGG - Intergenic
942321483 2:174740446-174740468 TTAGCCTTAAGAAGGAATCCTGG - Intergenic
942492171 2:176500328-176500350 GATGGCATAAATGGGAATCCTGG + Intergenic
943396571 2:187344194-187344216 GCTGCCATAGAAAGGAACGCAGG - Exonic
943949675 2:194116675-194116697 GTTTCCATAAAAAGCAATGTTGG - Intergenic
945220479 2:207478495-207478517 CTTGCCATCAAAAGGAAGTCAGG + Intergenic
945220519 2:207478938-207478960 CTTGCCATCAAAAGGAAGTCAGG - Intergenic
945872075 2:215238020-215238042 GTTGCCATAAAAAGCACTTTTGG + Intergenic
1169638617 20:7722770-7722792 GTTGCCAAAGAAAGTAATACTGG + Intergenic
1170785499 20:19463748-19463770 GTGGCCAGAAAATGGAATCAGGG + Intronic
1171325204 20:24285077-24285099 ATTGTAATAAAAACGAATCCAGG + Intergenic
1173905415 20:46624889-46624911 GTTCCCATATATAGGAAACCAGG + Intronic
1174569351 20:51490579-51490601 GCTGCCATAAATAGGAAACCAGG + Intronic
1177087784 21:16728853-16728875 GTTGCCACAAAAAGCAAAGCAGG - Intergenic
1177321525 21:19527284-19527306 GATGCCATAAAAAGACATCGAGG - Intergenic
1180167099 21:46035937-46035959 CTTGCCAGACAACGGAATCCAGG + Intergenic
1180860892 22:19081685-19081707 GTTTCCCTAAATAGAAATCCTGG + Intronic
1182584045 22:31333166-31333188 TTTGCCACAAAAATGACTCCTGG - Intronic
1183718025 22:39545625-39545647 GTTGACACAGAAACGAATCCAGG - Intergenic
950136983 3:10588438-10588460 GTTGCCATCAGAAGGCATCTAGG - Intronic
951957178 3:28270086-28270108 GCAGCCATAAAAAGGAATGAGGG - Intronic
952007190 3:28855430-28855452 GTTGCCAAGAAAACCAATCCCGG - Intergenic
956279905 3:67545256-67545278 GTTGCCATAAAAAGGAATCCAGG + Intronic
956835324 3:73091799-73091821 GTTCCTAGAAATAGGAATCCTGG + Intergenic
957771513 3:84698649-84698671 CTGGTAATAAAAAGGAATCCAGG + Intergenic
960778083 3:121284473-121284495 GTAGCCATACAAATGAATCTAGG - Intronic
961240840 3:125409936-125409958 TTTTCCATTAAAAGGAATCAGGG - Intergenic
961893403 3:130148535-130148557 GTGGCCATCAGAAGGAAGCCTGG - Intergenic
962319771 3:134381045-134381067 GATGTTATAAAGAGGAATCCTGG - Intergenic
963436202 3:145270091-145270113 ATTGCCATAACAAGAAAGCCTGG + Intergenic
964708965 3:159651435-159651457 TTTGTCATAAAAAGGCTTCCAGG - Intronic
965691553 3:171362325-171362347 TTTGCCATTAAAAGTAATACTGG + Intronic
970547367 4:17143495-17143517 GTTGCTAGAAAGAGCAATCCCGG + Intergenic
971619731 4:28840876-28840898 GTTGCTATAAAAAAGTATCTAGG - Intergenic
972197380 4:36670781-36670803 GGTGCCATATACATGAATCCTGG - Intergenic
972588514 4:40461490-40461512 TTTGCCATAAAAAGGGATTTGGG - Intronic
972705082 4:41534460-41534482 GATGCCATTAATAGGAATCATGG + Intronic
975374260 4:73624666-73624688 ATTGCCTTAAAGAGGAAGCCAGG + Intergenic
978015466 4:103739469-103739491 GTTCCCATAATAAAGAATCAGGG - Intergenic
978493078 4:109329682-109329704 TTTTCCATAAAATGGAAACCTGG - Intergenic
979921871 4:126507171-126507193 GTTGCCAGAATAAGATATCCAGG + Intergenic
980803458 4:137783245-137783267 GTTGCCATATAAATGAATTAGGG + Intergenic
982626251 4:157770165-157770187 GTTTCCATCAAAAGAAAACCTGG - Intergenic
985608935 5:875645-875667 GTTGCTATAAAAAAGCATCTGGG - Intronic
986197645 5:5552749-5552771 GCTGCCATTAAAAAGAAGCCAGG - Intergenic
988632806 5:32949200-32949222 GTTGGCATTGAAAGGAATTCTGG - Intergenic
990058937 5:51622388-51622410 GTTAACATAAAACAGAATCCCGG + Intergenic
990303733 5:54474784-54474806 GTTGCCTCAAAAAGAAACCCTGG + Intergenic
995327977 5:110913155-110913177 GTTTCAATGAAAATGAATCCAGG - Intergenic
995532299 5:113103579-113103601 GTTTCTATAAGTAGGAATCCTGG - Intronic
996838193 5:127817454-127817476 TTATCCATAAAAAGGAATTCTGG + Intergenic
1000604964 5:163318210-163318232 TTGGCCATCAAAAGGAAGCCTGG - Intergenic
1000914327 5:167061805-167061827 GTTTCAATTAAAAGGAACCCTGG + Intergenic
1005148435 6:22720033-22720055 ATTGCAATAAAAATGAATCATGG - Intergenic
1008217428 6:48810424-48810446 GTTGCAATAAAAAAAAGTCCAGG - Intergenic
1009703821 6:67219533-67219555 GTTGGCAGAGAAAGGACTCCAGG + Intergenic
1011372151 6:86648742-86648764 TGTGCCATAAAAATAAATCCCGG + Intergenic
1011585775 6:88923870-88923892 GTTGCCAGAGAAAGGAATCTTGG - Intronic
1013130669 6:107229613-107229635 GTTGCCATAAAAATGGATGAAGG - Intronic
1013601682 6:111711249-111711271 ATTGTGATAAAAAGAAATCCTGG - Intronic
1016600378 6:145852021-145852043 GTTGCACCAAAAAGGAATCCAGG + Intergenic
1016905838 6:149150095-149150117 GTTGACATAGAAAGATATCCTGG + Intergenic
1021507944 7:21405933-21405955 TTTGCACTAAAAAGGTATCCTGG + Intergenic
1021889101 7:25169876-25169898 GTAGCCATTAAAAGGAATGAAGG - Intronic
1023854285 7:44172308-44172330 GTTGTCATAAACATGAATGCAGG - Intronic
1031220105 7:118954472-118954494 ATTGCCAAAAAAAGAAGTCCAGG - Intergenic
1031499730 7:122499017-122499039 ATTAACATAAAAAGCAATCCTGG - Intronic
1032071994 7:128813678-128813700 GTTCCCATAAAAAGAATTCTAGG + Intronic
1033104521 7:138508834-138508856 TTTCCCATGAAAAGGAATCAAGG - Intronic
1034318500 7:150157243-150157265 GCTACCATTAGAAGGAATCCAGG - Intergenic
1034774252 7:153809989-153810011 GCTACCATTAGAAGGAATCCAGG + Intergenic
1034906713 7:154954948-154954970 TTTTCCTTAAAAAGGAAACCAGG + Intronic
1037129073 8:15385736-15385758 GTTTCCCTAAAATGGAATCCTGG + Intergenic
1038823195 8:30972355-30972377 TTTGCCATTAAAAGTAATGCAGG + Intergenic
1040598534 8:48862777-48862799 GATGCCATAAAAGAGAAGCCTGG + Intergenic
1040829077 8:51657923-51657945 GGTGCCATAGAAAGGTCTCCAGG + Intronic
1041200391 8:55448419-55448441 TTTGCAATCAAAATGAATCCAGG + Intronic
1044902780 8:96966487-96966509 ATAGCCACAATAAGGAATCCAGG + Intronic
1044908662 8:97032718-97032740 GTTGCTAGACAAAGGCATCCTGG - Intronic
1045456366 8:102383505-102383527 GTTTCCCCAAAGAGGAATCCTGG - Intronic
1047148098 8:122228833-122228855 ATTGCCAACAAAAGAAATCCAGG + Intergenic
1047715011 8:127587432-127587454 GTTGGCAGTAAAAGTAATCCAGG - Intergenic
1051941619 9:22512820-22512842 ATTGGAATAAAAAGGAATACAGG - Intergenic
1056681276 9:88721191-88721213 GTTGCCAGAAAAAACAACCCTGG - Intergenic
1058858939 9:109095382-109095404 GTTGCTATAAAAAGAAATGCTGG + Intronic
1185783885 X:2873127-2873149 GTCGCGATTAAAAGGAATCAGGG + Intronic
1187421302 X:19136259-19136281 TTGGCCATAAAAAGGAATGAAGG + Intergenic
1187819484 X:23271361-23271383 GATGGCATAAAAAAGAGTCCAGG - Intergenic
1188905972 X:35792811-35792833 GTGACCAGAAAAAGGAATCGTGG + Intergenic
1189126283 X:38450533-38450555 TTTGCCACAAAAAGGAATCAGGG - Intronic
1189444375 X:41067110-41067132 GTTGCCATAAAACAAAATCTAGG - Intergenic
1197222595 X:123928082-123928104 GTTGCCATATAAAGAAGTGCAGG - Intergenic
1197240911 X:124122362-124122384 GTTGTCATAAAATAGTATCCTGG + Intronic
1197910756 X:131480346-131480368 ATTGCCAGAAAAAAGAATTCAGG + Intergenic
1198066304 X:133099872-133099894 TTAGCCATAAAAAGGAATAAAGG - Intergenic
1198210275 X:134509730-134509752 GTTGTCATAAAAAGAAATTTTGG - Intronic
1198294355 X:135271218-135271240 GTTGCCATAAAAAGAGTTACTGG + Intronic
1198319790 X:135509136-135509158 GCTGCCATAAAAAGATATCCAGG + Intergenic
1199096279 X:143744460-143744482 GATGCTATAAAAAAGAATCCAGG + Intergenic
1200315303 X:155126390-155126412 TTGGCCATAAAAAGGAATGAGGG + Intronic
1201554634 Y:15255550-15255572 TTGGCCATAAGAAGGAAGCCTGG + Intergenic
1202258473 Y:22944429-22944451 GTTCCCAGAAAAAGGAACACTGG + Intergenic
1202411462 Y:24578187-24578209 GTTCCCAGAAAAAGGAACACTGG + Intergenic
1202459320 Y:25091885-25091907 GTTCCCAGAAAAAGGAACACTGG - Intergenic