ID: 956286384

View in Genome Browser
Species Human (GRCh38)
Location 3:67614622-67614644
Sequence CTTCACAGGCTGAAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 328}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956286378_956286384 3 Left 956286378 3:67614596-67614618 CCTGACTGGCCCTTACTGACACA 0: 1
1: 0
2: 1
3: 11
4: 145
Right 956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 328
956286379_956286384 -6 Left 956286379 3:67614605-67614627 CCCTTACTGACACAGTGCTTCAC 0: 1
1: 0
2: 0
3: 16
4: 112
Right 956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 328
956286376_956286384 12 Left 956286376 3:67614587-67614609 CCCTGTCTTCCTGACTGGCCCTT 0: 1
1: 0
2: 2
3: 32
4: 308
Right 956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 328
956286380_956286384 -7 Left 956286380 3:67614606-67614628 CCTTACTGACACAGTGCTTCACA 0: 1
1: 0
2: 2
3: 11
4: 183
Right 956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 328
956286374_956286384 23 Left 956286374 3:67614576-67614598 CCTCACAAAATCCCTGTCTTCCT 0: 1
1: 0
2: 6
3: 35
4: 419
Right 956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 328
956286377_956286384 11 Left 956286377 3:67614588-67614610 CCTGTCTTCCTGACTGGCCCTTA 0: 1
1: 0
2: 2
3: 9
4: 220
Right 956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956286384 Original CRISPR CTTCACAGGCTGAAGGTGAA GGG Intronic
900896863 1:5488916-5488938 TTGCACAGGATAAAGGTGAATGG - Intergenic
900924728 1:5697577-5697599 CTTCACAGAGTGAAGGCGGAAGG - Intergenic
901217470 1:7562848-7562870 GTTGACAGGCTGCAGGTGAGTGG - Intronic
901332448 1:8421882-8421904 CTCCACTGTCTGAAGGCGAAGGG - Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
907101310 1:51839267-51839289 CTTGACAGGCTGAAGATGGGAGG - Intronic
907768609 1:57437128-57437150 CTTCAGATGGTGAAAGTGAATGG + Intronic
909561750 1:77015828-77015850 CTTCACAGGCAAAAGGTTAGAGG + Intronic
909667844 1:78155334-78155356 CTTCACAGGCTGTTGGGCAAAGG - Intergenic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
911530284 1:99036221-99036243 TTTTACAGGCTCAAGGTGGAAGG - Intergenic
911669781 1:100594670-100594692 CTACATAGGCTGAAAGTGAAAGG - Intergenic
912516591 1:110220218-110220240 CTTCTCAGGGTGGAGGTGAGGGG + Intronic
913061145 1:115209305-115209327 ATTCTCAGGATGATGGTGAAGGG + Intergenic
914410177 1:147419808-147419830 TTTCTCAGGCTGTAGGTGATGGG - Intergenic
915298694 1:154939870-154939892 CTCAGCAGGCTGAAGGTGGAAGG - Intergenic
916077109 1:161207784-161207806 CTTCAGATACTGAAGGAGAAAGG - Intronic
916707316 1:167364680-167364702 CTCCAGAGGCTGAGGGAGAATGG - Intronic
917481945 1:175419826-175419848 CTGCAAAGGCTGAGGGAGAAAGG - Intronic
917665526 1:177221975-177221997 GACCACAGGATGAAGGTGAAAGG + Intronic
917812615 1:178674150-178674172 CTACATAGGCTAAAAGTGAATGG + Intergenic
918632302 1:186732319-186732341 CTCCATAGGCTCACGGTGAAGGG - Intergenic
918867293 1:189919151-189919173 ACCCACAGGCTGAAGGTAAATGG - Intergenic
920698116 1:208197350-208197372 TTACTCAGGCTGAGGGTGAATGG + Intronic
921297793 1:213721240-213721262 CATCACATGCTGAAGAAGAAGGG - Intergenic
921919325 1:220648596-220648618 TTTCAAAGGCTGATGGTGAATGG - Intronic
924816943 1:247451090-247451112 TTTCTCAGGGTGTAGGTGAAGGG + Exonic
1063013894 10:2055095-2055117 CATAACAGGCTGATGGTGGAAGG + Intergenic
1064398289 10:14999167-14999189 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
1064399308 10:15007945-15007967 TTTCTCAGGCTGTAGATGAAAGG + Intergenic
1064438922 10:15335648-15335670 ATTCACAGCCTGAAAGTGACAGG + Intronic
1065500064 10:26372037-26372059 CTTACCAGTCTGAAGATGAAGGG - Intergenic
1066979281 10:42396697-42396719 GGTCACAGACTGAAGATGAATGG + Intergenic
1067741239 10:48897464-48897486 CTGCACAGGTTGAAAATGAACGG - Exonic
1068356633 10:55918348-55918370 ATGCACAGACTGAAAGTGAAGGG + Intergenic
1068851914 10:61751975-61751997 ATTCGCAGACTGTAGGTGAAAGG + Intronic
1070602193 10:77873656-77873678 CTTTACAAGCTCCAGGTGAATGG - Intronic
1070730942 10:78827964-78827986 CATCACAGGCTGGAGGTGGAGGG - Intergenic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1071342019 10:84658173-84658195 CTTCAGCCACTGAAGGTGAATGG + Intergenic
1071939036 10:90567156-90567178 TTTCATAGACTGAAAGTGAAGGG - Intergenic
1072922216 10:99585777-99585799 CTTCATAGAGTGAGGGTGAAGGG + Intergenic
1076210678 10:128642220-128642242 ATTCACAGGCTGGAGGAGGATGG + Intergenic
1077480219 11:2811104-2811126 GTGCACAGCCTGAGGGTGAAGGG - Intronic
1077576902 11:3390856-3390878 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
1078832112 11:14987754-14987776 TTTCTCAGGCTGCAGATGAAGGG + Intronic
1079040254 11:17052916-17052938 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
1081885045 11:46487937-46487959 CTAAACAGGCTGAAAGTAAAAGG + Intronic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1082666202 11:55979196-55979218 TTTCTCAGGCTGCAGATGAAGGG + Intergenic
1083094427 11:60234936-60234958 AAACACAGGCTGAAAGTGAAGGG + Intronic
1083276061 11:61597774-61597796 CCTCACTGGCTGGAGGGGAACGG - Intergenic
1084846428 11:71904051-71904073 TTTCTCAGGCTGTAGATGAAGGG - Intronic
1085471099 11:76758651-76758673 CTGCACAGGCTGAGTGTGAAGGG + Intergenic
1085560465 11:77468111-77468133 CTTAACAGTCTGAAAGGGAAAGG + Intronic
1086444188 11:86857122-86857144 TTTCTCAGGCTGTAGATGAAAGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087253754 11:95932810-95932832 ATTCATAGTCTGAAAGTGAAAGG + Intergenic
1088703612 11:112438900-112438922 ACACACAGGCTGAAAGTGAAAGG - Intergenic
1089427165 11:118387853-118387875 ATTCCCAGGATGACGGTGAAAGG + Intronic
1090184125 11:124725274-124725296 CTTCAGGGCCTGAAGGTGCAGGG - Intergenic
1091432536 12:448685-448707 ATTCACAGACTGAAAGGGAAAGG + Intergenic
1092433501 12:8427708-8427730 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
1094294968 12:28895375-28895397 CGTGGCAAGCTGAAGGTGAAAGG + Intergenic
1095381931 12:41605283-41605305 CTTGAAAGGATGAAGGAGAAAGG + Intergenic
1096648760 12:53051841-53051863 TTTCCTAGGCTGAAGGTGGAGGG - Exonic
1099016527 12:77349915-77349937 TGTCACAGGCTGAGGGTTAATGG + Intergenic
1099224545 12:79953962-79953984 ACACACAGGCTGAAGGTGAAGGG - Intergenic
1099557493 12:84128465-84128487 CTTCAGAGCCTGCAGGGGAAGGG - Intergenic
1099797142 12:87413218-87413240 GTTAGCAGGCTGAAGGTAAAAGG + Intergenic
1102256631 12:111418918-111418940 CTCCCCAGGGTGAAGGCGAAGGG - Intronic
1102607016 12:114075670-114075692 CTTAAAAGGCTGAAGGTGCAGGG - Intergenic
1103013803 12:117478540-117478562 CTTCATAGGCTGAAGATGGGAGG - Intronic
1104870903 12:131994667-131994689 ATTCACAGCCTGAAGTGGAAGGG + Intronic
1105401786 13:20102643-20102665 CTTCACACGCTGAGGATTAAAGG - Intergenic
1105880745 13:24604616-24604638 ATCCACAGGCTGAAAGTAAAGGG - Intergenic
1106029618 13:25988297-25988319 CTGCACAGGCAGATGGTGAAAGG + Intronic
1107484829 13:40815745-40815767 ATCCACAGGCTGAAAGTAAAGGG + Intergenic
1107545649 13:41431310-41431332 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
1107546674 13:41439919-41439941 TTTCTCAGGCTGTAGATGAAAGG + Intergenic
1107547100 13:41443595-41443617 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
1108052606 13:46461071-46461093 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
1108422753 13:50267385-50267407 TTTTACAGGCCGAAGCTGAACGG + Intronic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1109538407 13:63742754-63742776 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
1109545431 13:63837018-63837040 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
1109840454 13:67911880-67911902 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
1110192764 13:72750315-72750337 CTGAACAGCCTCAAGGTGAATGG + Intronic
1110488466 13:76073630-76073652 ACTTACAGGCTGAAGGTGAAGGG + Intergenic
1113951273 13:114072344-114072366 CTTCACACGCTCAAGTTGAGGGG + Intronic
1114367587 14:22046519-22046541 CTTCCCGGGATTAAGGTGAAAGG - Intergenic
1114463172 14:22901328-22901350 CTTGACAGACTAAAGGTTAAAGG + Exonic
1114947121 14:27697118-27697140 CTTCACTGGCTGTAGGTGGGAGG - Intergenic
1115718060 14:36127557-36127579 CTTCACTGGCTGTTGGTCAAAGG - Intergenic
1116350341 14:43854129-43854151 CTTCACTGGCTGAGGATGCAAGG + Intergenic
1116947797 14:50852458-50852480 CTTGGCAGGATGAAGGTGTAGGG - Intergenic
1118371827 14:65144185-65144207 CATGACAGGCTGCAGTTGAAAGG - Intergenic
1118626963 14:67668424-67668446 ATTCAAAGGCAGAAAGTGAATGG + Intronic
1119037198 14:71240470-71240492 CTTCACAGTCTGACAATGAAAGG + Intergenic
1119181360 14:72607384-72607406 CTTCACATGGTGAAGGGGCAAGG + Intergenic
1119382356 14:74237359-74237381 TGCCAGAGGCTGAAGGTGAAGGG - Intergenic
1119468282 14:74876681-74876703 CTTCTCAAGCTGAAGGAGGAGGG - Intergenic
1120677090 14:87433279-87433301 AGTCACAGACTGAAGGTTAATGG + Intergenic
1120957673 14:90097300-90097322 CTTAACATGGTGAAGGTCAAAGG + Intronic
1121639275 14:95474498-95474520 CTTCCCAGACAGAAGGTGAAGGG + Intronic
1122244951 14:100395835-100395857 CTGCACAGACTGGAGGTGAGGGG - Intronic
1123519624 15:21059974-21059996 TTTCCCAGGCTGAAGGTCAGTGG + Intergenic
1124549946 15:30670666-30670688 CTTCACAGGATTGAGGTGACTGG + Intronic
1124812173 15:32952072-32952094 CCTCTGAGGCTGAAGGTGCATGG - Intronic
1126499649 15:49331144-49331166 CTTGACATGCTGAAAGTAAAAGG + Intronic
1126794961 15:52253122-52253144 CTACACAGGCTGAGGGCAAAAGG + Intronic
1127195836 15:56584456-56584478 CTACATAGGCTGAAAGTGAAGGG - Intergenic
1129029278 15:72606749-72606771 ATAAACAGGCTGAAGGTTAATGG - Intergenic
1129474934 15:75778624-75778646 ATAAACAGGCTGAAGGTCAATGG - Intergenic
1129921571 15:79323629-79323651 CCTCAGAGGGTGAAGGAGAAGGG - Intronic
1131552724 15:93372077-93372099 CTTCACCGGCTCGAGGTGAAGGG + Intergenic
1131720022 15:95157763-95157785 ATTCACAGCCAGAAGTTGAATGG - Intergenic
1131828512 15:96339461-96339483 TCTCACAGACTGAAGGTAAAGGG - Exonic
1132007917 15:98247499-98247521 ACTCACAGGCTCAAGGTAAAGGG - Intergenic
1132238545 15:100239901-100239923 CTTCACTGGCTGAGGGTGGAGGG - Intronic
1132992437 16:2803002-2803024 ACACACAGGCTGAAAGTGAAAGG - Intergenic
1133168158 16:3963715-3963737 CTACACAGCCTGGAGGGGAAAGG + Exonic
1134088912 16:11379489-11379511 TTACACAGGTTGAAAGTGAAAGG - Intronic
1134843031 16:17416538-17416560 CTGCACAGGCTGATTGTGATAGG - Intronic
1134887278 16:17804802-17804824 GTTGACAGGCAGAAGGTCAAGGG - Intergenic
1135029380 16:19025861-19025883 CTTCGGAGGCTTGAGGTGAAAGG - Intronic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1137451598 16:48579739-48579761 TCACACAGACTGAAGGTGAAGGG + Intronic
1138905753 16:61330177-61330199 ACTTACAGGCTGAAAGTGAATGG - Intergenic
1139062474 16:63270115-63270137 CTTCACAGGCAGAATGGGACAGG - Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1140937190 16:79684279-79684301 TTGCACAGGCTGGAGGTCAATGG + Intergenic
1141569866 16:84928049-84928071 CCTCACAGCCTGAAGGTCAATGG - Intergenic
1141716320 16:85729128-85729150 CTCCACAGACGGAAGGGGAAAGG - Intronic
1141756664 16:85995876-85995898 CTTCAGAGGCGAAAGGGGAAGGG + Intergenic
1144084902 17:11799689-11799711 CTTCAGAGGCTGAGGCAGAATGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1148193931 17:45699886-45699908 CTTCACATGTTACAGGTGAAGGG - Intergenic
1148687383 17:49508432-49508454 CTTCAGAGCCTGAAGCTGAAAGG - Intronic
1149159880 17:53679488-53679510 ATACATAGGCTGAAGCTGAAAGG - Intergenic
1149731321 17:58949360-58949382 ATACACAGACTGAAAGTGAAGGG - Intronic
1150512066 17:65764632-65764654 ATACATAGGCTGAAAGTGAAGGG - Intronic
1150512205 17:65766657-65766679 ATACATAGGCTGAAAGTGAAGGG + Intronic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1152404645 17:80089870-80089892 ATCCACAGGATGAAGGTGAGGGG + Exonic
1156182207 18:34618477-34618499 CTTCACAGGCTGGAGTAGATAGG + Intronic
1156360065 18:36377215-36377237 ATTCACAGGCTGAAGAAGAAGGG - Intronic
1159898911 18:74023603-74023625 CACCACTGGCAGAAGGTGAAGGG - Intergenic
1161390145 19:4016453-4016475 CTTCAGAGGCTGAAGGGCACAGG - Intronic
1162213756 19:9114883-9114905 TTTCTCAGGCTGTAGATGAAGGG + Exonic
1162222748 19:9192087-9192109 TTTCTCAGGCTGTAGATGAACGG - Intergenic
1162224079 19:9205164-9205186 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
1162230908 19:9265439-9265461 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
1163131530 19:15276425-15276447 GATCAAAGGCTGAAGGTGACAGG - Intronic
1163267035 19:16227736-16227758 CTTCACCTCCTGGAGGTGAAGGG - Intronic
1165047580 19:33117844-33117866 ACGCACAGGCTGAAGGAGAAGGG + Exonic
925157165 2:1657242-1657264 GTTCCCAGTCTGAAGGTGACAGG - Intronic
926000230 2:9324788-9324810 ATTCACAGGTTGAATGTAAAAGG - Intronic
926887275 2:17609796-17609818 CTTCATATGCTGTAGGTGATGGG + Intronic
927089174 2:19697550-19697572 CCACCCAGGTTGAAGGTGAAGGG + Intergenic
928296730 2:30090200-30090222 CTGCTAAGGGTGAAGGTGAAGGG - Intergenic
928361999 2:30671069-30671091 TTTCCCTGGCTGAAGGTAAAAGG - Intergenic
928756759 2:34535457-34535479 ATTCACAGGAGGAAGCTGAAAGG - Intergenic
929963596 2:46515808-46515830 ACACACAGGCTGAGGGTGAAAGG + Intronic
930203600 2:48566887-48566909 CGTTACAGGCTGAAGTTGAAAGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931544494 2:63366786-63366808 TTTCATAGTATGAAGGTGAAAGG + Intronic
932350791 2:71029786-71029808 TTTCTCAGGCTGTAGATGAAAGG - Intergenic
933403714 2:81831061-81831083 ACTTACAGACTGAAGGTGAAGGG + Intergenic
934590691 2:95547445-95547467 TTTCTCAGGCTGTAGATGAAAGG - Intergenic
936630622 2:114199018-114199040 CTTTCCAGGCTGAGGGAGAAAGG - Intergenic
937068184 2:119036142-119036164 ATATATAGGCTGAAGGTGAAGGG + Intergenic
937332305 2:121039091-121039113 CTTCCCAGGCTGTAGGAGGAAGG - Intergenic
940280552 2:151984631-151984653 CATCAAAGGCTGAATGTGAAAGG - Intronic
940871367 2:158863205-158863227 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
941116988 2:161482914-161482936 ATACATAGGCTGAAAGTGAAGGG + Intronic
942326137 2:174778594-174778616 CCTAACACGCTGAAGATGAAAGG + Intergenic
946491143 2:220150304-220150326 ATTCACAGTCTGAAAGTGTATGG - Intergenic
947653958 2:231810491-231810513 TTTCACCTGCTGAAGCTGAAGGG - Intergenic
948944320 2:241211731-241211753 CATCAAAGGCTGAAGGTTACAGG - Intronic
1169894736 20:10490792-10490814 GTTCACAGGGAGAAGGAGAATGG - Intronic
1170800341 20:19585086-19585108 CTTCACTGTCTGAAGGAAAAGGG + Intronic
1172681532 20:36719584-36719606 CTCCAGAGGCTGCAGGTGAAGGG + Intronic
1173148785 20:40548122-40548144 CTCCACAGGCTGCAGGAAAATGG + Intergenic
1173288379 20:41693040-41693062 CTTCACAGGCTGATGGGGAAGGG + Intergenic
1173965804 20:47111778-47111800 CTTCAGAGGGTGAAGATGTAAGG + Intronic
1175257144 20:57654398-57654420 CTACCCAGGCTGCAGGTGAGCGG - Intronic
1175984274 20:62756147-62756169 CATCACTGGCTGAAGGTGCCTGG - Intronic
1176926487 21:14756103-14756125 CCACACAGGCTGAAAGTGAAAGG + Intergenic
1177488839 21:21794681-21794703 ATTCAGAGGGTGAAAGTGAAGGG + Intergenic
1177570435 21:22878914-22878936 CTTCATAGTCTGATGGTGACAGG + Intergenic
1179253529 21:39695350-39695372 CTGGACTGGCTGAAGGTAAAGGG + Intergenic
1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG + Intronic
1179523708 21:41961890-41961912 CTTCACAGACTGAAAGAGAAGGG - Intergenic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1180028161 21:45180686-45180708 ATTCACAGGATGAAGATGACAGG - Intronic
1180900631 22:19369427-19369449 CTTTACAGGCCTAAGGTTAAGGG + Intronic
1184820020 22:46903251-46903273 CATCCCAGGCTGCAGGCGAAGGG + Intronic
1185232210 22:49689764-49689786 CTTCTCACACTGAAGGTGGAGGG - Intergenic
949885393 3:8689050-8689072 TTTCTCAGGCTGTAGATGAAAGG - Intronic
952684177 3:36130638-36130660 CTTCAGAGTCTGAAGGTCAAAGG - Intergenic
953213775 3:40898689-40898711 GGTCTCAGGCTGAAGGTGGAAGG + Intergenic
953310361 3:41872028-41872050 CTTCACAGGATTGAGGTGACTGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955456587 3:59128414-59128436 CCTCACAGGCTTAGGGTCAAGGG - Intergenic
955471850 3:59294647-59294669 TTTCACAGGCTGGTGTTGAATGG + Intergenic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956595752 3:70965282-70965304 CTGCCCATGCTGAATGTGAATGG - Intronic
957042601 3:75347893-75347915 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
957043585 3:75356573-75356595 TTTCTCAGGCTGTAGATGAAAGG + Intergenic
957045433 3:75370459-75370481 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
958907926 3:99962144-99962166 CTGGAAAGGCTGAAGGTGAGGGG + Intronic
959047382 3:101489433-101489455 ATTCACAGGCTCAAAGTAAAGGG + Intronic
959464088 3:106664627-106664649 ATACATAGACTGAAGGTGAAGGG + Intergenic
959621637 3:108404478-108404500 CTTCACACGCTGTAGATCAAAGG - Intronic
960873479 3:122274228-122274250 GTTCACAGACTGCAGGTTAAGGG + Intronic
961066387 3:123880706-123880728 CTTCAGTGTCTGAGGGTGAATGG - Intronic
961273063 3:125704233-125704255 TTTCTCAGGCTGTAGATGAAAGG - Intergenic
961274069 3:125713001-125713023 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
961276956 3:125735158-125735180 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
961404958 3:126672321-126672343 ATTCCCAGGGTGAATGTGAATGG + Intergenic
961540159 3:127593950-127593972 CATCACAGTCTGAAGGAGACTGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963573017 3:147021016-147021038 ATACACAGACTGAAAGTGAAGGG + Intergenic
964761968 3:160142822-160142844 CTTCACAGGATTACAGTGAAAGG + Intergenic
964922217 3:161911019-161911041 CTTTACTGGCTGAAGAAGAAAGG - Intergenic
965395571 3:168157188-168157210 GCTCACAGGCTGATGATGAAAGG - Intergenic
967508680 3:190284633-190284655 ATACACAGACTGAAGGTAAAGGG - Intergenic
967925532 3:194642984-194643006 CTTCACAGGCTCATTGTGTAAGG + Intronic
968989711 4:3901615-3901637 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
969603282 4:8189444-8189466 CGTCACAGCCTGGAGGAGAAGGG + Intronic
969735014 4:8982309-8982331 TTTCTCAGGCTGTAGATGAAAGG - Intergenic
969787424 4:9469912-9469934 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
969825598 4:9755737-9755759 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
970010763 4:11456390-11456412 CTTCACAGGATGAATATGAAGGG - Intergenic
970291153 4:14573704-14573726 GTTTCCAGGCTCAAGGTGAAAGG - Intergenic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
971154181 4:24064444-24064466 CACCACAGGCTGAGGGGGAAAGG + Intergenic
971401184 4:26276871-26276893 TTTCACAGGTTGAAGAAGAAAGG - Intronic
971825057 4:31610380-31610402 CTCCAGAGGCTGAAGTGGAATGG + Intergenic
972327511 4:38031324-38031346 CTTCACAAGTTAAAGGTTAATGG + Intronic
972400836 4:38702114-38702136 TTTCACAGGTTGGAGATGAAAGG + Intergenic
972834395 4:42851739-42851761 ATACACAGGCTGAAAGTGAAGGG - Intergenic
973144619 4:46810100-46810122 ATACAGAGGCTGAAAGTGAAGGG - Intronic
973579578 4:52329262-52329284 ACTCACAGACTGAAAGTGAAGGG - Intergenic
974075582 4:57165501-57165523 CTGCACTGGCTCAAGATGAAGGG - Intergenic
976572874 4:86633471-86633493 TTTCACTGGCTTGAGGTGAAAGG + Intronic
977504909 4:97888984-97889006 TTACAATGGCTGAAGGTGAAGGG - Intronic
977872515 4:102109018-102109040 ACACACAGGCTGAAAGTGAAAGG + Intergenic
978104247 4:104882440-104882462 CTCCTCAGCCTGAAGGTAAAGGG + Intergenic
979862849 4:125715906-125715928 CTTCACATGGTGAAGGGAAAAGG - Intergenic
980979331 4:139640840-139640862 TTTCACAGGCTGAATGGAAAGGG - Intergenic
981044054 4:140250378-140250400 CTAAAAAGGCTGCAGGTGAACGG - Intergenic
982161953 4:152579293-152579315 CTGCACAGGCTGAAGCTCAGGGG - Intergenic
982557523 4:156886813-156886835 GTTCACAGGCTGAGGATGACAGG + Intronic
982959954 4:161823553-161823575 CTTCTGAGCCTGAAGGGGAAGGG + Intronic
983062292 4:163173687-163173709 CTTCAAAGTCTCAAGGTCAAAGG - Intergenic
984325105 4:178241661-178241683 CTTCCAAGCCTGAGGGTGAAAGG - Intergenic
986442997 5:7797821-7797843 GTTCACAGGCTGGAAGTGAGGGG - Intronic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
986637730 5:9839660-9839682 CTTCACAGGCTTAACATGAGAGG + Intergenic
988879754 5:35488462-35488484 CTTCAAAGTCAGAGGGTGAAGGG - Intergenic
988943757 5:36173453-36173475 CTTCTCTGTCTGCAGGTGAAGGG + Intronic
991090180 5:62686802-62686824 CTTCACATGCTGACAGTCAAGGG + Intergenic
993435384 5:87886615-87886637 CTTCACAGGGTGAAGAAAAAGGG - Intergenic
993677226 5:90831123-90831145 TTTCACAGGCTGAAGACCAAAGG - Intronic
996231647 5:121070558-121070580 TTTCAGTGGCTGTAGGTGAAAGG - Intergenic
996303347 5:122016197-122016219 CTTCCCAGGATGATGGTGACAGG - Intronic
996684027 5:126259926-126259948 ATACACAGACTGAACGTGAAGGG + Intergenic
1000075496 5:157781224-157781246 ATTCGCAGGCTAAAGGTGGATGG - Intergenic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1000443939 5:161297145-161297167 CTTGACAGGCTGAAGTGGGAGGG + Intronic
1001377519 5:171276105-171276127 GTGCACAGCATGAAGGTGAAAGG + Intronic
1001691307 5:173634516-173634538 CTTCACAGGCTTGAAATGAATGG + Intergenic
1002207704 5:177575012-177575034 TCTAACAGGCTGAAGGTCAAGGG - Intergenic
1003116500 6:3287077-3287099 CTCCACAGGCTGACGGGGTACGG - Exonic
1003330046 6:5122197-5122219 CATCACCGGATGAAGGTGACAGG - Intronic
1003970097 6:11291010-11291032 TTTCACATGCTGGAAGTGAAAGG + Intronic
1005103369 6:22197961-22197983 CTTCCCTCTCTGAAGGTGAAGGG + Intergenic
1005568778 6:27124377-27124399 CTTCAGAGGCTGAAGGAACATGG - Intergenic
1008089478 6:47279017-47279039 CTTCACAGTCTGAAGGAAAAAGG + Intronic
1008691828 6:53987733-53987755 CTGCTCAGGCTGAGGGCGAAAGG - Intronic
1009796129 6:68470572-68470594 GCTCTCAGGCTGAAGGTGAGTGG - Intergenic
1010365375 6:75044570-75044592 AAACACAGGCTGAAAGTGAAAGG + Intergenic
1010738264 6:79467967-79467989 CTTCACAGGCTACAGTTCAAAGG + Intergenic
1013351969 6:109313987-109314009 TTGCACAGGCTGCATGTGAAAGG + Intergenic
1014022603 6:116608306-116608328 ACTCACAGGCTCAAGGTAAAGGG + Intergenic
1014563186 6:122915321-122915343 ACTCACAGGCTGAAAGTTAAGGG - Intergenic
1020262985 7:6541234-6541256 CGTCACGGGGTGAAAGTGAAGGG + Intronic
1020310768 7:6866738-6866760 TTTCTCAGGCTGTAGATGAAAGG + Intergenic
1021210081 7:17839542-17839564 CACCACAGGCTGAAAGTAAAAGG - Intronic
1021768726 7:23976828-23976850 ACACACAGACTGAAGGTGAAGGG - Intergenic
1021912179 7:25397167-25397189 CTGCTCTGGCTGAAGCTGAAAGG + Intergenic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1023348926 7:39300099-39300121 CATCAGTGGCTGAAGGTGATTGG - Intronic
1024083887 7:45877920-45877942 TTTTACAGGCCCAAGGTGAAAGG - Intergenic
1026710215 7:72731600-72731622 ATACACAGACTGAAAGTGAATGG + Intronic
1026738596 7:72964568-72964590 ATTCACAGGATGAGGGAGAAAGG - Intronic
1027105138 7:75400501-75400523 ATTCACAGGATGAGGGAGAAAGG + Intronic
1028747613 7:94345959-94345981 CTTCATAGGCTGGAGGTGGGTGG - Intergenic
1029077480 7:97947065-97947087 TTTCTCAGGCTGTAGATGAAAGG + Intergenic
1029080072 7:97966138-97966160 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
1029920550 7:104257820-104257842 CTGCACAGGCTGGAGGGCAATGG - Intergenic
1030344116 7:108413972-108413994 CTACACAGGATGAGGGTGCAGGG - Intronic
1031426857 7:121615685-121615707 CTTTACAGACTGAAGGTTAAAGG + Intergenic
1032265905 7:130369868-130369890 TTTCACAGGCTGAATGGAAAGGG - Intergenic
1035481917 7:159193704-159193726 ATCCACAAGCTGCAGGTGAAAGG + Intergenic
1035617029 8:1009712-1009734 CTACACACGCAGCAGGTGAAAGG - Intergenic
1036070048 8:5432143-5432165 ATACACAGGCTGAAAGTGAAAGG + Intergenic
1036394179 8:8352843-8352865 ATACATAAGCTGAAGGTGAAGGG + Intronic
1036904454 8:12696340-12696362 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
1037932480 8:22890180-22890202 ATCCAGGGGCTGAAGGTGAAAGG + Intronic
1038715970 8:29991528-29991550 CTTCTCAGTCACAAGGTGAATGG + Intergenic
1039908715 8:41807474-41807496 ATTCACAGGAAGAAGGTGAAAGG - Intronic
1039965976 8:42284178-42284200 CATCATAGGGTGAAGGCGAAAGG + Intronic
1040899138 8:52400270-52400292 ATACACAGGCTGAAAGTGAAGGG - Intronic
1041959141 8:63592025-63592047 ACACACAGGCTGAAAGTGAAGGG - Intergenic
1044451514 8:92340641-92340663 ATGCATAGGCTGAAAGTGAAGGG - Intergenic
1044509875 8:93062536-93062558 AATCATAGGCTGAAAGTGAAAGG + Intergenic
1044668606 8:94655947-94655969 CTCCAGAGGCTGAAGCTGGAGGG + Intronic
1047103226 8:121704050-121704072 CTTCAGAAGTTGAAGCTGAAAGG + Intergenic
1048544117 8:135370173-135370195 CTTCACATTCTGAAGAAGAATGG + Intergenic
1049818878 8:144622179-144622201 CTGCACAGGCCCAAGGTGAGGGG + Intergenic
1051520379 9:17980880-17980902 CTGCCCATGCAGAAGGTGAAGGG + Intergenic
1051960602 9:22757942-22757964 ATACATAGGCTGAAAGTGAAGGG - Intergenic
1052326108 9:27218167-27218189 CATCAGAGGCTGGCGGTGAAAGG + Intronic
1053107909 9:35428653-35428675 ATACATAGGCTGAAAGTGAAGGG + Intergenic
1053421878 9:37984866-37984888 CCTCAGAGGCTGAGGGTGAGTGG + Intronic
1054760038 9:68996363-68996385 CTCTACAGTGTGAAGGTGAATGG - Intronic
1056548906 9:87635487-87635509 CTTCCCAGGAAGAAGGTGAGGGG - Intronic
1056650424 9:88455414-88455436 CTGCACAGGCTGAAGTGCAATGG - Intronic
1056864420 9:90216890-90216912 TTTCTCAGGCTGTAGATGAAGGG - Intergenic
1056866654 9:90233013-90233035 TTTCTCAGGCTGTAGATGAAAGG - Intergenic
1056915478 9:90742548-90742570 TTTCTCAGGCTGTAGATGAAGGG + Intergenic
1056916506 9:90751306-90751328 TTTCTCAGGCTGTAGATGAAAGG + Intergenic
1058648300 9:107151268-107151290 TCTCACAGCCTGAAGGAGAAGGG + Intergenic
1058652025 9:107184317-107184339 AATCATGGGCTGAAGGTGAAGGG + Intergenic
1060747656 9:126148313-126148335 CTTCACAGGCAGAACCTGAGAGG + Intergenic
1060898102 9:127232260-127232282 CTTCAGTAGCTGAAGGAGAAGGG - Intronic
1061306618 9:129736245-129736267 CTTCCCAAGCTCAAGGTGGAGGG + Intergenic
1062296399 9:135830338-135830360 ACACACAGGCTGAAAGTGAAGGG + Intronic
1185661812 X:1734439-1734461 CTTCTCAGGCTGGAGATGAGCGG + Intergenic
1186096600 X:6109156-6109178 CTCCAGAGGCTGAGGGTGGAGGG + Intronic
1186267346 X:7846319-7846341 CTTCTCAGGCAAAAGGAGAAAGG + Intergenic
1186376542 X:9009024-9009046 CTTCTCAGGCAAAAGGAGAAAGG + Intergenic
1188049155 X:25463470-25463492 ACACACAGGCTGAAAGTGAAGGG - Intergenic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1188928396 X:36074790-36074812 CATCAGAGGCTGAAGGTTGAGGG - Intronic
1189006102 X:36997001-36997023 ACACACAGGCTGAAAGTGAAAGG + Intergenic
1189739510 X:44103503-44103525 GTTCACAGCCTGGAGGAGAAAGG - Intergenic
1192563169 X:72140733-72140755 CTCCTCAGGCTGACAGTGAAAGG + Exonic
1192896320 X:75446354-75446376 ATTCAAAGGCTTAAGGAGAATGG + Intronic
1193140946 X:78026209-78026231 ACTCATAGGTTGAAGGTGAAGGG + Intronic
1193471149 X:81906203-81906225 TCTCACAGACTGAAGGTAAAGGG - Intergenic
1195407183 X:104527604-104527626 ATACACAGACTGAAAGTGAAGGG + Intergenic
1195734999 X:108003070-108003092 GTTCATAGGCTCAAGGTAAAGGG + Intergenic
1195907058 X:109854499-109854521 ATTCCCAGGATGAAGGTGAAAGG + Intergenic
1196126177 X:112101948-112101970 CTTGAAAGGCTGTAGGGGAAGGG - Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1199997794 X:153037378-153037400 CTGGACTGGCTGATGGTGAAGGG - Intergenic
1200290350 X:154866025-154866047 ATACATAGGCTGAAAGTGAAGGG + Intronic