ID: 956296064

View in Genome Browser
Species Human (GRCh38)
Location 3:67715039-67715061
Sequence CTAATCCAGTGTGTTCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956296064_956296069 9 Left 956296064 3:67715039-67715061 CCCTGAGGAACACACTGGATTAG No data
Right 956296069 3:67715071-67715093 AAGAGCTACTCTGTAACCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956296064 Original CRISPR CTAATCCAGTGTGTTCCTCA GGG (reversed) Intergenic
No off target data available for this crispr