ID: 956301989

View in Genome Browser
Species Human (GRCh38)
Location 3:67781911-67781933
Sequence GAGGGTGAACTGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2473
Summary {0: 4, 1: 175, 2: 458, 3: 742, 4: 1094}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956301989_956302000 23 Left 956301989 3:67781911-67781933 CCACCCTGCTTCAGTTCACCCTC 0: 4
1: 175
2: 458
3: 742
4: 1094
Right 956302000 3:67781957-67781979 CCAGTCCCAATGAGATGAACTGG 0: 152
1: 412
2: 383
3: 237
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956301989 Original CRISPR GAGGGTGAACTGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr