ID: 956301989 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:67781911-67781933 |
| Sequence | GAGGGTGAACTGAAGCAGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2473 | |||
| Summary | {0: 4, 1: 175, 2: 458, 3: 742, 4: 1094} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 956301989_956302000 | 23 | Left | 956301989 | 3:67781911-67781933 | CCACCCTGCTTCAGTTCACCCTC | 0: 4 1: 175 2: 458 3: 742 4: 1094 |
||
| Right | 956302000 | 3:67781957-67781979 | CCAGTCCCAATGAGATGAACTGG | 0: 152 1: 412 2: 383 3: 237 4: 225 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 956301989 | Original CRISPR | GAGGGTGAACTGAAGCAGGG TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||