ID: 956303011

View in Genome Browser
Species Human (GRCh38)
Location 3:67792863-67792885
Sequence GAGCCCTTCCAAATAGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956303006_956303011 15 Left 956303006 3:67792825-67792847 CCAGTGCCACCAAGATTGATAAC No data
Right 956303011 3:67792863-67792885 GAGCCCTTCCAAATAGCCCATGG No data
956303008_956303011 6 Left 956303008 3:67792834-67792856 CCAAGATTGATAACATCTCACAT No data
Right 956303011 3:67792863-67792885 GAGCCCTTCCAAATAGCCCATGG No data
956303005_956303011 16 Left 956303005 3:67792824-67792846 CCCAGTGCCACCAAGATTGATAA No data
Right 956303011 3:67792863-67792885 GAGCCCTTCCAAATAGCCCATGG No data
956303007_956303011 9 Left 956303007 3:67792831-67792853 CCACCAAGATTGATAACATCTCA No data
Right 956303011 3:67792863-67792885 GAGCCCTTCCAAATAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956303011 Original CRISPR GAGCCCTTCCAAATAGCCCA TGG Intergenic
No off target data available for this crispr