ID: 956309025

View in Genome Browser
Species Human (GRCh38)
Location 3:67858739-67858761
Sequence TTTGGGTACCAGTTTGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956309020_956309025 18 Left 956309020 3:67858698-67858720 CCAATCCCTGTTTGCAGGTTAAG No data
Right 956309025 3:67858739-67858761 TTTGGGTACCAGTTTGTGCAAGG No data
956309022_956309025 12 Left 956309022 3:67858704-67858726 CCTGTTTGCAGGTTAAGAAGAAA No data
Right 956309025 3:67858739-67858761 TTTGGGTACCAGTTTGTGCAAGG No data
956309021_956309025 13 Left 956309021 3:67858703-67858725 CCCTGTTTGCAGGTTAAGAAGAA No data
Right 956309025 3:67858739-67858761 TTTGGGTACCAGTTTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956309025 Original CRISPR TTTGGGTACCAGTTTGTGCA AGG Intergenic
No off target data available for this crispr