ID: 956310364

View in Genome Browser
Species Human (GRCh38)
Location 3:67871866-67871888
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956310361_956310364 2 Left 956310361 3:67871841-67871863 CCACTTGCATTAGATGCTAGAGC No data
Right 956310364 3:67871866-67871888 AAGTGGGTATAGAATGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr