ID: 956316612

View in Genome Browser
Species Human (GRCh38)
Location 3:67944691-67944713
Sequence ATTTTTCCTTTTAAGAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956316610_956316612 20 Left 956316610 3:67944648-67944670 CCACATCACTGGGGAATTTTCAA No data
Right 956316612 3:67944691-67944713 ATTTTTCCTTTTAAGAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956316612 Original CRISPR ATTTTTCCTTTTAAGAGCTA AGG Intergenic
No off target data available for this crispr